ID: 1102581249

View in Genome Browser
Species Human (GRCh38)
Location 12:113889486-113889508
Sequence GACACATGGTCTCCCTCATC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 120}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102581243_1102581249 20 Left 1102581243 12:113889443-113889465 CCTGAGTCAATCTGGGGAAATTT 0: 1
1: 0
2: 3
3: 41
4: 280
Right 1102581249 12:113889486-113889508 GACACATGGTCTCCCTCATCTGG 0: 1
1: 0
2: 0
3: 8
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102581249 Original CRISPR GACACATGGTCTCCCTCATC TGG Intronic
902124094 1:14194074-14194096 GAAACATGTCTTCCCTCATCTGG + Intergenic
904365138 1:30006035-30006057 GACCCATGCTCTCCCCTATCAGG + Intergenic
905286611 1:36884486-36884508 CACACATGGCCTCCTTCCTCAGG - Intronic
907460966 1:54605252-54605274 GAGACACTCTCTCCCTCATCAGG - Intronic
908743598 1:67354245-67354267 CACACCTGCTCTCCCTCACCTGG - Intronic
908927002 1:69267583-69267605 GCCATATGGTCTCACTCATGAGG - Intergenic
912264088 1:108137973-108137995 CACACATGCTTTCCCTCAACTGG + Intronic
916375915 1:164152949-164152971 GACACATGGCCTCCCTGTTGGGG - Intergenic
918645029 1:186893896-186893918 GAGACAGGGTCTCACTCACCAGG - Intronic
920037672 1:203076362-203076384 GACACATGCTCTCCGCCTTCCGG + Exonic
924313282 1:242769147-242769169 ACCACATGGTCTCACTCATGTGG + Intergenic
1067551221 10:47237798-47237820 GACACATGATTTCCCTCCCCTGG - Intergenic
1067572109 10:47379251-47379273 GACACATAGCTTCCCTCATATGG - Intronic
1069327739 10:67251845-67251867 GAGACATGGTATCCAGCATCAGG + Intronic
1070085241 10:73230659-73230681 GGGACATGGTCTCCACCATCAGG + Intronic
1070833476 10:79434031-79434053 GAGACATGGTCCTCATCATCTGG + Intronic
1071171546 10:82870575-82870597 TCCACATGGTCTCCATCATTTGG + Intronic
1071243567 10:83738053-83738075 GAGACAGGGTCTCCCTTTTCAGG - Intergenic
1072292395 10:93976042-93976064 GACACAGGGTCTCACTCAGTTGG - Intergenic
1073463641 10:103681136-103681158 GGCAGATGGTGTCTCTCATCAGG + Intronic
1074536503 10:114331944-114331966 TACACAGGGTCTCCTTCCTCAGG + Intronic
1083940955 11:65895552-65895574 GTGAAATGGTCTCTCTCATCTGG - Intronic
1094821465 12:34229409-34229431 GAGACATGGTCTCACTCCTCAGG + Intergenic
1097600420 12:61685372-61685394 GACACAGGGGCTACTTCATCAGG - Intergenic
1102581249 12:113889486-113889508 GACACATGGTCTCCCTCATCTGG + Intronic
1106185984 13:27410565-27410587 GAGACAAGGTCTCCATCACCAGG + Intergenic
1107660506 13:42634392-42634414 GACCCAAGGTGTCCCTCAACAGG - Intergenic
1110343200 13:74416088-74416110 GACACATTGGATTCCTCATCTGG - Intergenic
1110467877 13:75823784-75823806 GCCACATTGTCTTCCACATCTGG + Exonic
1111879596 13:93939074-93939096 GACACAGCGTCTCCGTCAGCAGG - Intronic
1118787386 14:69057222-69057244 TACACATGGTCTCCAGCATGTGG + Intronic
1119375711 14:74190855-74190877 GACACTTGGTGGCCCTCAGCAGG - Intronic
1119739794 14:77006947-77006969 GAGACATGGTCTCGCTCTGCTGG + Intergenic
1120248455 14:82033002-82033024 GTCACATGATCTCACCCATCAGG - Intergenic
1124973621 15:34514356-34514378 GACCCATGGTCGCCCTCAGTCGG - Intergenic
1127298648 15:57631587-57631609 CACACAGGGTCTCTCTCAGCTGG + Intronic
1128872069 15:71166591-71166613 GCCACATGGTATCCCCCACCAGG - Intronic
1129903845 15:79172356-79172378 GTTACAAGGTCTTCCTCATCAGG + Intergenic
1132125677 15:99222287-99222309 GAGACAGGGTCTCACTCACCTGG + Intronic
1134063841 16:11214187-11214209 GAGATAGGGTCTCCCTCATCTGG - Intergenic
1136043961 16:27601267-27601289 TACACATGGCCTCCCCCATCAGG - Intronic
1137694450 16:50452129-50452151 CACCCTTGGTCTCCCTCATCAGG + Intergenic
1138291227 16:55848752-55848774 GGCACATGGACTCCCTAAACTGG - Intronic
1144493393 17:15732882-15732904 GACACATGGGGTCCCTTGTCTGG + Intronic
1144554879 17:16273377-16273399 GACACATGGTCTTTGTGATCTGG - Intronic
1144640358 17:16933422-16933444 GACACATGGAGTCCTTCGTCTGG - Intronic
1144906868 17:18643770-18643792 GACACATGGGGTCCCTTGTCTGG - Intronic
1147148195 17:38498320-38498342 GAGACATGGGCTCTGTCATCAGG + Intronic
1147246830 17:39127236-39127258 TACGCACGGTCTACCTCATCTGG + Intronic
1150417123 17:64996682-64996704 GACACCTGGTTTTCCTCCTCTGG - Intergenic
1150794541 17:68227240-68227262 GACACCTGGTTTTCCTCCTCTGG + Intergenic
1151353021 17:73542739-73542761 GACACTTGGTCTCCCTCCCTGGG + Intronic
1158501390 18:58005295-58005317 GACACAGGGTCTCTATCATCTGG - Intergenic
1160299809 18:77669328-77669350 GATGTATGGTCCCCCTCATCAGG - Intergenic
1161297445 19:3527007-3527029 GACACATCGTTGCCGTCATCGGG - Exonic
1163401126 19:17093486-17093508 GCCACATGGTATCGCTCACCTGG - Intronic
1164047554 19:21555580-21555602 GCCACGTGGTCTCGCTCAGCAGG - Intronic
1166069703 19:40379845-40379867 AGCACATGCTCACCCTCATCAGG - Intronic
1166670852 19:44708830-44708852 GAGACATGGTCCCCAACATCTGG - Intronic
1168668050 19:58219148-58219170 GAGACAAGGTCTCCCTCTGCTGG - Intergenic
932418609 2:71588335-71588357 GACACCTGTTCTCCCACCTCTGG - Intronic
935666801 2:105519146-105519168 GACACACTTGCTCCCTCATCTGG + Intergenic
942178404 2:173355928-173355950 TACACATGGTTTTCTTCATCCGG - Intronic
944595705 2:201258650-201258672 GATACACGGTCTCCCTCCTGTGG + Intronic
948548890 2:238754147-238754169 GACATATGTGGTCCCTCATCAGG - Intergenic
1169810841 20:9607629-9607651 GATACAGGGTCTCCCTAGTCTGG - Intronic
1173078690 20:39845569-39845591 GACACCTGCTCTCGCTCAGCAGG - Intergenic
1174465111 20:50711339-50711361 GTCTGATGGTGTCCCTCATCCGG - Intergenic
1174742132 20:53025445-53025467 GATACATGGACTTCATCATCTGG - Intronic
1179777417 21:43675058-43675080 GACACAGGACCTCCTTCATCAGG - Exonic
1180013841 21:45070082-45070104 CACCCATCGTCTCCCTCTTCTGG + Intergenic
1181428621 22:22862170-22862192 GTCACATGTTCTCTCTCATGTGG + Intronic
1182951003 22:34375822-34375844 GGCACAAGTCCTCCCTCATCTGG - Intergenic
1185249714 22:49794306-49794328 GACACATGCTGTCAGTCATCAGG + Intronic
950353669 3:12383139-12383161 TACACATTGTATCCTTCATCAGG + Intronic
950704209 3:14769953-14769975 GAAGCATGGTCCCCCTCACCTGG - Intronic
950975683 3:17241027-17241049 TAACCATGTTCTCCCTCATCTGG + Intronic
951149214 3:19267292-19267314 GTCCCATTGTCTCCATCATCAGG - Intronic
951646035 3:24892127-24892149 GAAACATGTCCTCCTTCATCTGG - Intergenic
952677140 3:36046390-36046412 GCCACATGTTCTCACTCATGTGG - Intergenic
952991531 3:38835172-38835194 GGCACAGGGTCTCCCTCACAAGG + Intergenic
953209237 3:40859906-40859928 GACCCTTGGCCTCCCTCATCAGG + Intergenic
954148116 3:48644277-48644299 GAAACATGGTCCCGTTCATCTGG + Exonic
961222378 3:125211511-125211533 GAAACCTTGTCTACCTCATCTGG + Intronic
962085417 3:132186211-132186233 GAAACATGGTTTCTGTCATCAGG + Intronic
962456170 3:135567496-135567518 GACACGTGCTCTCCCTCACATGG - Intergenic
976985959 4:91298388-91298410 GACACATAGGCTCCCACATACGG - Intronic
977828101 4:101557248-101557270 GAAACATGTTCTCCCTTACCAGG - Intronic
978716536 4:111850225-111850247 GCCACATGGACTTCCTCATAGGG + Intergenic
981320982 4:143390997-143391019 GTCACATGGCCGCCCACATCTGG + Intronic
982238712 4:153277177-153277199 GCCAAATGGTTTCCCTCCTCGGG + Intronic
982915556 4:161204116-161204138 GCCAAGTGGTCTCCCTCAGCAGG + Intergenic
993044431 5:82851507-82851529 GCCACATGGTCTACTTCGTCTGG + Intergenic
1001656405 5:173354263-173354285 GAGACAGGGTCTCCCTAAACAGG + Intergenic
1003923647 6:10856449-10856471 GAGACAAGGTCTCACTAATCAGG - Intronic
1008414095 6:51219225-51219247 GATACCTGGTTTCCCTCCTCAGG + Intergenic
1012553111 6:100482212-100482234 GAAAGATGGACTCCCTCAACTGG - Intergenic
1014478597 6:121906532-121906554 GCCACATGATCTCACTCATGTGG - Intergenic
1014737891 6:125116092-125116114 CACACATTCACTCCCTCATCTGG - Intergenic
1017539970 6:155391078-155391100 GCCACATGTTCTCACTCATATGG + Intergenic
1018354481 6:162998359-162998381 GGCCCATGGTCTCCATCACCTGG + Intronic
1020708042 7:11570260-11570282 AACACATGTTCTCACTCATATGG + Intronic
1021021976 7:15611982-15612004 TACACATGATCTCACACATCTGG + Exonic
1023039297 7:36158302-36158324 CACCCATCCTCTCCCTCATCAGG + Intronic
1023347941 7:39290657-39290679 GACACATGGTCTGCCTCTTAAGG - Intronic
1023772500 7:43571014-43571036 GACACCTGGACTCCTACATCTGG - Intergenic
1032514302 7:132495438-132495460 GTCACCTGGTCTGCCTCTTCAGG - Intronic
1033511589 7:142065159-142065181 GACTCATTATCTCCATCATCTGG + Intronic
1034010917 7:147528633-147528655 GACAAATGGCCTCTCTCTTCTGG + Intronic
1037185640 8:16059090-16059112 GACACATGTCATCCCTCTTCAGG - Intergenic
1042813496 8:72852046-72852068 GAAACAGGGTCTCCCTCTGCTGG - Intronic
1045477660 8:102567038-102567060 GATGCTTGGTCCCCCTCATCTGG + Intergenic
1045734222 8:105276454-105276476 GACAAATGGATACCCTCATCTGG + Intronic
1046219924 8:111200849-111200871 GCCACATGGTCTGGCTCAGCTGG + Intergenic
1048565791 8:135595685-135595707 GACACTTGGCATCTCTCATCTGG + Intronic
1052628308 9:31004925-31004947 GACAAGTGGTCTCACTCAGCAGG + Intergenic
1053377188 9:37617624-37617646 GACACAGTGTCTCCCGAATCCGG - Intronic
1057212435 9:93207404-93207426 GACAGATGCTCACCCTCCTCAGG - Intronic
1062570522 9:137183002-137183024 GACACAAGGTCTCCCCCGGCTGG - Intronic
1189882927 X:45510792-45510814 CACCCTTGGTCTCCCTAATCTGG + Intergenic
1190561500 X:51690686-51690708 GACACAGGCTCTCCCTGAGCAGG - Intergenic
1190562791 X:51702629-51702651 GACACAGGCTCTCCCTGAGCAGG + Intergenic
1191802696 X:65098920-65098942 GCTACATGGTCTCACTCAGCAGG + Intergenic
1195600999 X:106748682-106748704 GTCACATGTTCTCACTCATGTGG + Intronic
1196866779 X:120077784-120077806 AACGCGTGCTCTCCCTCATCCGG - Intergenic
1196876320 X:120158497-120158519 AACGCGTGCTCTCCCTCATCCGG + Intergenic
1200141815 X:153906272-153906294 GACACGTGGGCTCCCTCACCGGG - Exonic
1201854054 Y:18521186-18521208 GCCAAGTGGTCTCACTCATCAGG + Intergenic
1201879267 Y:18799198-18799220 GCCAAGTGGTCTCACTCATCAGG - Intronic