ID: 1102581671

View in Genome Browser
Species Human (GRCh38)
Location 12:113892387-113892409
Sequence ATTGTTGCCCAGTGGGGACT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 3, 3: 14, 4: 143}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102581661_1102581671 29 Left 1102581661 12:113892335-113892357 CCAGAGGCATAGGAAAAAATGAT 0: 1
1: 0
2: 12
3: 96
4: 518
Right 1102581671 12:113892387-113892409 ATTGTTGCCCAGTGGGGACTGGG 0: 1
1: 0
2: 3
3: 14
4: 143

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102581671 Original CRISPR ATTGTTGCCCAGTGGGGACT GGG Intronic
900189731 1:1348309-1348331 TTTGTGGCTCAGTGGGGACGGGG + Intronic
900942745 1:5811554-5811576 ATTCTTGCCCAGCAGGGACAGGG + Intergenic
901021867 1:6260143-6260165 TTTGTTGCGCAATGGGGCCTCGG - Intronic
901350473 1:8591161-8591183 CTTGTTGCCCCGTGGAGGCTGGG - Intronic
901823716 1:11847129-11847151 ATTGGAGCCCAGAGCGGACTGGG - Exonic
903304202 1:22401204-22401226 ATCTTTGCCCAGTGCGGCCTGGG - Intergenic
904455934 1:30648043-30648065 CTTGGTGCCCTGTGGGTACTTGG - Intergenic
904517212 1:31065705-31065727 ATGGCGGCCCACTGGGGACTGGG + Intronic
904876030 1:33655114-33655136 ATGGTTGCCCAGATGGGAGTGGG + Intronic
906210137 1:44008286-44008308 ATGGTTGCCCAGTGGGGACAGGG + Intronic
916089575 1:161297124-161297146 ATTGCTGCACAGTGGGGACAAGG + Intergenic
916198013 1:162243187-162243209 ATTGTAGCCGAGAGGGGACAAGG + Intronic
918399974 1:184153523-184153545 ATTTTTGCCCAGTGGGTATTTGG + Intergenic
920930116 1:210380243-210380265 ATTAAAGCACAGTGGGGACTGGG + Intronic
920972155 1:210752076-210752098 ATTGTAGCCCAGTGGGGCAAAGG + Intronic
921714242 1:218401826-218401848 CTTGATGCCCAGTCGGGACGCGG - Intronic
922376332 1:224971267-224971289 GTTTTTGTCCATTGGGGACTAGG + Intronic
922649792 1:227327843-227327865 ATAGTTGTCAAGTGGGGGCTAGG + Intergenic
923063165 1:230495537-230495559 AATGATGCCCAGTGGAAACTAGG - Intergenic
1062768157 10:80828-80850 CTTGTGGCCCAGTGGGTCCTTGG - Intergenic
1064628194 10:17282855-17282877 GTGGTGGCCCAGTGGGGACTCGG - Intergenic
1065010610 10:21417374-21417396 CTTTTTGCCCAGTTGGGATTAGG - Intergenic
1066010889 10:31192513-31192535 ATTATAGCCCAGTGGGGAGGGGG - Intergenic
1066207280 10:33202021-33202043 ATTTTTACCCAGAAGGGACTCGG - Intronic
1067353906 10:45505685-45505707 ATTATTTCCCAATGGGGATTCGG + Intronic
1069572539 10:69503144-69503166 ACTAATGCCCAGTGGGCACTGGG + Intronic
1070784458 10:79154877-79154899 GTTGCTGCCCAGTGTAGACTTGG - Intronic
1071756958 10:88553397-88553419 ATTGAGGCCAAGTGGGGACCTGG - Intronic
1074714288 10:116203717-116203739 ATTGTTGCTCACTGGGGACCAGG - Intronic
1076250160 10:128978879-128978901 ATTGCTGCCCAGTGGGGACAGGG - Intergenic
1076537446 10:131189345-131189367 AATGGTGGACAGTGGGGACTTGG - Intronic
1078539202 11:12199868-12199890 ATTATTACCCAGTGGGGAGCAGG - Intronic
1079094353 11:17501295-17501317 CTTGGTGCCAAGTGGGGCCTGGG + Intronic
1079246943 11:18759504-18759526 ATTGCTGACCAGTGGGCACCTGG + Intronic
1080009361 11:27441999-27442021 ATTGTTGCCCATAGGTCACTGGG - Intronic
1081561447 11:44220882-44220904 CTTGTTCTCCAATGGGGACTGGG - Intronic
1081631864 11:44694770-44694792 ATTATATCCCAGTGGGGACAAGG - Intergenic
1081873729 11:46395049-46395071 TTTGTTGCCCAGGCTGGACTTGG + Intergenic
1084545320 11:69812459-69812481 ACTGTGGCCCAGGGGGCACTGGG - Intronic
1087126172 11:94627738-94627760 ATTCTTGGCCAGTGGGCCCTGGG - Intergenic
1092948316 12:13476723-13476745 ATTCTTCCCCAGTTGGGGCTGGG + Intergenic
1093875214 12:24341845-24341867 AAAGCTGCCCAGTGGGCACTGGG - Intergenic
1094229373 12:28085343-28085365 AATGATTCCCAGTGGGGAATAGG - Intergenic
1095559969 12:43552417-43552439 ATTGGTGCCCAGCCGGGCCTTGG - Intergenic
1096011902 12:48224898-48224920 ACTGGGGCCCATTGGGGACTGGG + Intergenic
1098110104 12:67112663-67112685 AATGTTTCCCAGAGGGGACTGGG - Intergenic
1098456619 12:70681478-70681500 ATGCATCCCCAGTGGGGACTAGG - Intronic
1099125945 12:78758193-78758215 ATTGCATCACAGTGGGGACTGGG - Intergenic
1099877057 12:88420608-88420630 ACTGTTTCCCTGTGGGGAATAGG - Intergenic
1100391094 12:94147310-94147332 ATCATTGCCCACTGGGGAATAGG - Intergenic
1100828946 12:98500636-98500658 ATTTTTGCCCAGTGCTGACAGGG + Intronic
1101861505 12:108486073-108486095 AATGTTGCCCACTGGAGACCTGG - Intergenic
1102581671 12:113892387-113892409 ATTGTTGCCCAGTGGGGACTGGG + Intronic
1105928603 13:25031868-25031890 ATTGTTACCCACTGGGGAGAAGG + Intergenic
1106053071 13:26209659-26209681 ATTGTTACCCACTGGGGAGAAGG + Intronic
1107572538 13:41678113-41678135 ATTGTGGGCCTCTGGGGACTTGG + Intronic
1110332522 13:74288876-74288898 CTTGTTGACCAGTGGGGAGCAGG - Intergenic
1112135556 13:96574527-96574549 ATTGGTGCCCACAGGGGAGTGGG - Intronic
1113560349 13:111273802-111273824 CTTGCTGCCCAGTGAGGAGTTGG + Exonic
1116669121 14:47818052-47818074 ATGGCTTCCCAGTGGGGACTGGG + Intergenic
1119336035 14:73834439-73834461 TTTGTGGACCAGTGCGGACTTGG + Intergenic
1122257627 14:100490576-100490598 ATTGCTGCCCAGGGTGGCCTAGG + Intronic
1125576525 15:40759499-40759521 TTTGTTGCCCAGTGTGATCTGGG + Intergenic
1126790889 15:52220298-52220320 ATTGTTGCCCAGTGGGAATGTGG - Intronic
1126892819 15:53224192-53224214 ATTGTCCACCAGTGGGGACCAGG - Intergenic
1128702872 15:69816839-69816861 AGGGTTGGCCAGTGGGGGCTGGG + Intergenic
1129245970 15:74278886-74278908 AGTGTGGGCCAGTGGGCACTCGG - Intronic
1132231951 15:100190928-100190950 TATGTGGCCCAGTGGAGACTCGG - Intronic
1132776424 16:1597327-1597349 ATTGGTGCACTGTGGGCACTTGG + Intronic
1135511734 16:23090631-23090653 CTTGTTGCCCAGTGCAGGCTCGG + Exonic
1136244636 16:28967379-28967401 ATTGTTGCCCAGGCTGGAGTGGG - Intergenic
1137355313 16:47756862-47756884 AATGATGAGCAGTGGGGACTTGG + Intergenic
1137940019 16:52674924-52674946 ATCTGTGCCCAGTGAGGACTGGG + Intergenic
1141684886 16:85564578-85564600 ATTCCTCACCAGTGGGGACTTGG + Intergenic
1143574431 17:7782207-7782229 GATGTTGCCCCTTGGGGACTGGG - Intronic
1144139832 17:12337471-12337493 TTGGTTTCCCAGTGGTGACTTGG + Intergenic
1151803073 17:76389044-76389066 ATGGTTGCCCAGTTTAGACTTGG - Intergenic
1156414053 18:36868737-36868759 ATTGTTCCCCAGTGAATACTTGG + Intronic
1157966024 18:52209208-52209230 TTTGTTGCCCAGTGAGCACTAGG - Intergenic
1159841490 18:73404083-73404105 TTTAGTCCCCAGTGGGGACTGGG + Intergenic
1160502689 18:79410201-79410223 CTTGTTGGCCAGGTGGGACTGGG + Intronic
1161607166 19:5221536-5221558 ATTGGGGCTCAGTCGGGACTGGG - Intronic
1162644565 19:12039444-12039466 ACTGTTCCCCAGTCTGGACTAGG - Intronic
1164882718 19:31748481-31748503 CATGTTGCCAAGTGGGGACAAGG - Intergenic
1166970639 19:46565004-46565026 ATTCATGACCAGTGGGAACTGGG - Intronic
1167136104 19:47616664-47616686 ATTGTGGCCCAGTGGGTATTTGG - Intronic
1168592932 19:57651955-57651977 AGGGTTACCCAGTGGTGACTGGG - Intergenic
930464744 2:51733690-51733712 ATTAATGCCCAGTGGAGGCTGGG - Intergenic
935734706 2:106097354-106097376 ACTGCTGGCCAGTGGGGCCTGGG - Intronic
938370676 2:130766524-130766546 TTTGTTGCCCAGGTGGGAATGGG + Exonic
938947086 2:136223169-136223191 ATTTTTGGCCAGTAGGGACACGG + Intergenic
939204402 2:139081397-139081419 ATTGTGGCCCAGTTGGTACATGG + Intergenic
939610868 2:144308713-144308735 TCTGTTGCCCAGTCAGGACTGGG - Intronic
947541238 2:230981325-230981347 ATTATTTTCCAGTGGGTACTGGG - Intergenic
948352672 2:237353792-237353814 AATGGTGCCCAGTGGGGACTTGG - Intronic
1176146515 20:63567938-63567960 ATCCCTGCCCAGTGGGGAGTGGG - Intronic
1176247900 20:64105944-64105966 ACTGATGACCAGTGGGGTCTGGG + Exonic
1176985437 21:15431018-15431040 ATGGATGCCCAGGTGGGACTGGG - Intergenic
1179414486 21:41187144-41187166 AGAGTTCCCCAGTGGGGAGTGGG - Intronic
1179979928 21:44890571-44890593 CATGGTGGCCAGTGGGGACTCGG + Intronic
1181446982 22:22984674-22984696 ATAGGTGCCCAGTGTGGACAAGG + Intergenic
1182359895 22:29740291-29740313 CTTGGTGCCAAGTGGGGACTGGG + Intronic
1183777626 22:39977341-39977363 ATGGTTTCCCAGTGGAGACCTGG - Intergenic
950983863 3:17339349-17339371 AGTGTTGCTCACAGGGGACTTGG - Intronic
952503071 3:33982216-33982238 ATTGTTGCACAGTTGTGTCTTGG + Intergenic
953296091 3:41718594-41718616 CTTGTTGCCCTGTAGGGAGTTGG - Intronic
956012638 3:64847820-64847842 GTTTTTGCCCACTGGGAACTGGG - Intergenic
956362990 3:68469286-68469308 ATTGCTGTCCAGTGGGAAGTAGG + Intronic
960736824 3:120790338-120790360 ATTTTTTCCCAGTGGGGAGGTGG + Intergenic
961943447 3:130660666-130660688 ACTGAAGCCCAGTGGTGACTTGG + Intronic
962762677 3:138530354-138530376 ATTGTAGCCTAGTGTGCACTGGG + Intronic
966167932 3:177041917-177041939 CTGATTGTCCAGTGGGGACTGGG - Intronic
970592082 4:17568539-17568561 CATGTTGCCCAGTGTGGTCTTGG - Intergenic
972513399 4:39790891-39790913 TTTGTTGCCCAGTCTGGTCTTGG - Intergenic
972515596 4:39807853-39807875 ATTGTTGCCCAGGCTGGAGTGGG - Intergenic
972697980 4:41466366-41466388 ATTGTTGTGAAGTGGGGCCTGGG - Intronic
977415682 4:96729942-96729964 ATTGTTCATCAGTGAGGACTGGG - Intergenic
978593189 4:110348881-110348903 ATTGGAGCCCTGTGGGGTCTAGG - Intergenic
979118980 4:116868736-116868758 ATTGTTGCCCAGGCTGGAGTGGG - Intergenic
979892128 4:126111388-126111410 GCTGTTGCCCAATAGGGACTAGG - Intergenic
980545779 4:134259948-134259970 GTAGTGCCCCAGTGGGGACTCGG + Intergenic
984428644 4:179620446-179620468 AATGTTGGACAATGGGGACTTGG + Intergenic
985535147 5:460518-460540 ATGGGCGGCCAGTGGGGACTTGG - Intronic
985535167 5:460593-460615 AGACTTGGCCAGTGGGGACTCGG - Intronic
985535181 5:460657-460679 AGACTTGGCCAGTGGGGACTTGG - Intronic
987545882 5:19309756-19309778 ACAGTGCCCCAGTGGGGACTGGG + Intergenic
993139879 5:84018734-84018756 ATTGTTGCCCTTTGGGGATTTGG - Intronic
998816188 5:146016693-146016715 AATGTTGCCTAGTGTGGTCTTGG - Intronic
998914182 5:146996498-146996520 ATTGTTACCCTGTTGGCACTAGG + Intronic
998932091 5:147192571-147192593 ATTCTTGCCCAGTGAGTACTTGG + Intergenic
999617678 5:153442136-153442158 AATGCTGCCCAGTGGGGGGTAGG + Intergenic
1002856127 6:1039777-1039799 ATTACTTCCCAGTGGGGGCTGGG - Intergenic
1003167931 6:3697595-3697617 AGTGATGCTCAGTAGGGACTAGG + Intergenic
1004653484 6:17634884-17634906 CTTTTTGTCCAGTGTGGACTAGG - Intronic
1005990636 6:30899642-30899664 AGTGTTGTCCAGTGGGGCCCAGG - Intronic
1007265996 6:40596346-40596368 AGTGTGGCACAGTGGGGAGTAGG - Intergenic
1009039942 6:58164094-58164116 ATTGTTGGTCACTGGGGGCTTGG + Intergenic
1011828608 6:91341142-91341164 ATTGTTGTCCTGTGGGAACTGGG + Intergenic
1012097146 6:94977188-94977210 ACAGTGCCCCAGTGGGGACTCGG + Intergenic
1015613835 6:135054533-135054555 AGTGTTGCCCTGTCGGGATTGGG - Intronic
1020061004 7:5152212-5152234 ATTTTTTCCCAGTGGAGACCTGG - Intergenic
1021566701 7:22023663-22023685 ATGGGTGCCCAGTGGGCACATGG - Intergenic
1029293985 7:99524871-99524893 AATATTGCCCAGTCGTGACTGGG + Intronic
1034137016 7:148780219-148780241 ATAGTGGCCCACTGGAGACTGGG + Intronic
1034359268 7:150479841-150479863 ATTGTTGCCCCGTTCAGACTTGG - Intergenic
1036709946 8:11071810-11071832 GTTATTGCCCAGTGGGGAGAGGG - Intronic
1038360298 8:26868812-26868834 ATTGTTGTAGAGTGGGGACTGGG - Intergenic
1041415609 8:57604889-57604911 ATTCCACCCCAGTGGGGACTAGG + Intergenic
1044593898 8:93940408-93940430 ATTGTGGCCGAGTGAGGGCTGGG - Intergenic
1044611330 8:94095266-94095288 ATTCTTCCCCAGTGTGGCCTTGG + Intergenic
1047441227 8:124880294-124880316 ATGGTTGCCAAGTGGGTACAAGG + Intergenic
1049983456 9:925890-925912 ACTGTAGCCCAGTGAGGCCTTGG - Intronic
1051725512 9:20084603-20084625 CTTGTTACCCAGTGGTGTCTGGG - Intergenic
1052821964 9:33144683-33144705 ATTGATCCCGAGAGGGGACTGGG - Intronic
1057397041 9:94689613-94689635 ATCGTGGCCCTGTGGGCACTGGG - Intergenic
1057933666 9:99218509-99218531 ATTTTTTCCCCTTGGGGACTAGG + Exonic
1060195278 9:121619635-121619657 ATTTTTTCCTAGTTGGGACTTGG + Intronic
1061033209 9:128099270-128099292 CTTGGTGCACAGTGGGCACTGGG - Intronic
1187123327 X:16430290-16430312 ATGGTCCCCCAGTGGAGACTGGG + Intergenic
1192721866 X:73707377-73707399 CTTGTTGCAGGGTGGGGACTGGG + Intergenic
1193183257 X:78483332-78483354 ACAGTGTCCCAGTGGGGACTCGG + Intergenic