ID: 1102583875

View in Genome Browser
Species Human (GRCh38)
Location 12:113909735-113909757
Sequence AAGTGGGTCTGGAGGTGAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 530
Summary {0: 1, 1: 1, 2: 1, 3: 50, 4: 477}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102583875_1102583884 21 Left 1102583875 12:113909735-113909757 CCTTCTCACCTCCAGACCCACTT 0: 1
1: 1
2: 1
3: 50
4: 477
Right 1102583884 12:113909779-113909801 CCCAAACAGTGTTCCTGACGTGG 0: 1
1: 0
2: 0
3: 7
4: 84

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102583875 Original CRISPR AAGTGGGTCTGGAGGTGAGA AGG (reversed) Intronic
900848185 1:5120635-5120657 AGGTGGGTGTGGAGGTGGGTAGG - Intergenic
900990952 1:6098064-6098086 AACTGGATGTGGGGGTGAGAAGG + Intronic
901820164 1:11823820-11823842 CAGTGTGGCTGGAGGTAAGAAGG + Exonic
901991505 1:13118167-13118189 AAGTTGGTGTAGAGGTAAGAGGG - Intergenic
902205382 1:14864596-14864618 AAGTGGGTATAAAGGTGGGACGG + Intronic
902708311 1:18221693-18221715 AAGTGGATCAGGAGTGGAGACGG - Intronic
902737247 1:18409245-18409267 AGCTGGGTCTGCAGGTGGGAGGG - Intergenic
903178626 1:21594663-21594685 AGGTGGGGCAGGAGGAGAGAGGG + Intergenic
904330030 1:29752817-29752839 AAATGGGTCTGGGGGTGGGTGGG + Intergenic
904517165 1:31065513-31065535 GAGTGGTTGTGGGGGTGAGAAGG - Intronic
904757322 1:32775221-32775243 AAGGGTGTCTGGATGTGAGCTGG - Exonic
904956125 1:34285302-34285324 TAGCGGGTGAGGAGGTGAGAAGG - Intergenic
905312927 1:37063091-37063113 CAGTGACACTGGAGGTGAGAGGG - Intergenic
905353830 1:37366990-37367012 AATTGGATCTCGAGGTGACAGGG + Intergenic
905870656 1:41402490-41402512 AAGCGGGTCTGCAGCTGGGAAGG + Intergenic
906157482 1:43622224-43622246 AGGTGGGTCTGGTGGACAGAAGG - Exonic
906189529 1:43887425-43887447 AAGTGGGTTTGGAGTGTAGAAGG + Intronic
906504922 1:46371809-46371831 AAGTGGGGGTGGAGGTGGGCGGG + Intergenic
906619127 1:47259928-47259950 AAGTCTTTCTGGAGGTGATAAGG - Intronic
907084901 1:51662473-51662495 AAGTGAGTCTTCAGGTGGGAGGG + Intronic
908986283 1:70027102-70027124 AAGTGTGTGTGGGGGTGGGAGGG - Intronic
909303303 1:74040040-74040062 ATGTGTGTCTGCACGTGAGATGG - Intronic
910047511 1:82935586-82935608 GAGTGGGTCTGGAGATGGGGAGG - Intergenic
911189519 1:94933648-94933670 AAGTAGGTGTGGAGGTAAGTTGG + Intergenic
911378651 1:97084473-97084495 AAGAGGATATGGAGGAGAGAGGG - Intronic
912324106 1:108741476-108741498 AAGTTGGCCTGGGGGTGAAAAGG + Intronic
912456912 1:109804096-109804118 AAGTGAGTGAGTAGGTGAGAGGG - Intergenic
912563925 1:110571610-110571632 ATGGGGGTCGGGAGGGGAGAGGG + Intergenic
912891760 1:113540594-113540616 AATTGGGTGTGGAGGTTAGAAGG + Intronic
912945512 1:114081011-114081033 AAGTGGAGGTGGAGGTGAGTGGG + Intergenic
914829446 1:151159988-151160010 GAGAGGGTCTGGAGGGGAGGGGG + Exonic
915054759 1:153116560-153116582 AGGTGGGGCTGGACGTGAGTAGG + Intergenic
915603085 1:156934719-156934741 ATCTGGGTCTGGGGGTGAGAGGG + Intergenic
915826544 1:159084287-159084309 AAGTGGGCTTGGAGGAGGGAAGG - Intronic
916425014 1:164671894-164671916 AAGAGGGTCTGGAGAAGAAAGGG - Intronic
917741414 1:177964941-177964963 ATGGGCTTCTGGAGGTGAGATGG + Intronic
918048500 1:180955142-180955164 AAGTGGGGCTGGAGAAGAGCAGG + Intergenic
918089650 1:181278084-181278106 ATGTGTGTCTGCACGTGAGATGG - Intergenic
918662188 1:187103333-187103355 AAAGGGGTCTGGATGGGAGAGGG - Intergenic
919502102 1:198349973-198349995 GAGTGGGGATGGAGGTGGGATGG + Intergenic
921291501 1:213662114-213662136 AAGTGTGTCTCGAGGGGAGTGGG - Intergenic
922209889 1:223478954-223478976 GAGAGGGTGAGGAGGTGAGAGGG + Intergenic
922210009 1:223479294-223479316 GAGAGGGTGGGGAGGTGAGAGGG + Intergenic
922779994 1:228244446-228244468 AAGTGGGCATGGAGGTCAAAGGG + Exonic
924335698 1:242985164-242985186 AATGGGCTCTGGAGGGGAGACGG - Intergenic
924946297 1:248849149-248849171 ATGTGGGTATGGAGGTGGGTGGG + Exonic
1062868985 10:882093-882115 AAGTGGGCCTGGGGGTGGGCTGG + Intronic
1064102154 10:12473088-12473110 ATGTGGGGCAGGAGGGGAGAGGG + Intronic
1066595180 10:37042640-37042662 ATGTGTGTCTGCACGTGAGATGG + Intergenic
1067087694 10:43251604-43251626 GACTGCGTCTGGAGGTGAGGTGG - Intronic
1067123096 10:43491505-43491527 GAGTGGTTCTGGAGCTCAGAAGG - Intergenic
1069104881 10:64371690-64371712 AAGTAGGTCCAGTGGTGAGAAGG + Intergenic
1069567345 10:69472628-69472650 AAGAGGGTCTGAAGGGGAAATGG + Intronic
1069653203 10:70066513-70066535 AACTGGAGCTGGAGGTCAGAGGG + Intronic
1070765441 10:79053582-79053604 AACTGGGTCTGGGAGGGAGAGGG + Intergenic
1070773437 10:79096149-79096171 GGGTGGGTCTGGAGGAGAGGGGG + Intronic
1072568947 10:96641948-96641970 CAGTGGCTCTGTAGGTGACAAGG - Intronic
1072743960 10:97927190-97927212 AGGAGGAACTGGAGGTGAGAAGG - Intronic
1072792006 10:98324863-98324885 AACTGGGTCTGGACGTTTGAGGG + Intergenic
1073249064 10:102110784-102110806 AAGTGGGTCTGGGAGTGCCAGGG - Intronic
1073295533 10:102436182-102436204 ATGTGGGGCTGGAGGGGTGAGGG - Intergenic
1074243079 10:111658398-111658420 AAATGGGTTTGGTGGTGAGAAGG - Intergenic
1074286891 10:112106039-112106061 ATGTGTGTCTGCACGTGAGACGG - Intergenic
1074476117 10:113776052-113776074 AAGTCAGCCTGGAGGTGAGCAGG + Intronic
1074713034 10:116193254-116193276 GAGTGGGTGTGGAGGTGGCAGGG - Intronic
1075138228 10:119806751-119806773 GGGTGGGCTTGGAGGTGAGAGGG - Intronic
1076644751 10:131945462-131945484 AAGTGCGTCTGTTGTTGAGATGG + Intronic
1076909107 10:133378759-133378781 CAGTGGGTCTGGGGGTGCCACGG - Intergenic
1076920994 10:133454594-133454616 AGGAGAGGCTGGAGGTGAGAGGG + Intergenic
1077299501 11:1840474-1840496 AGGTGGGTCTGCAGGGGAGCTGG + Intronic
1077445347 11:2588104-2588126 AAGGGGGTCTGGAGGTCACAGGG + Intronic
1077828325 11:5835063-5835085 CAGTGGGGCTGGAGGAAAGAGGG - Intronic
1078010752 11:7571264-7571286 AAGGTGGTTTGGAGCTGAGAAGG - Intronic
1078819593 11:14864059-14864081 ATGTGTGTCTGCACGTGAGATGG - Intronic
1080972465 11:37294841-37294863 TAGAGGGTCAGGAGGGGAGAGGG + Intergenic
1082063427 11:47879772-47879794 ATGTGTGTCTGGAGGTGGGGAGG - Intergenic
1082210785 11:49498653-49498675 ATGTGTGGCTGGAGGTGAGCTGG - Intergenic
1082777614 11:57259578-57259600 AAATAGTTGTGGAGGTGAGATGG + Intergenic
1082801271 11:57416531-57416553 GCTTGGGTCTGGAGGAGAGATGG + Intronic
1083316908 11:61821003-61821025 AGGTGGGTAAGGAGATGAGAGGG - Intronic
1083681604 11:64354169-64354191 AGGTGGGTCTGGGGGTCAGGTGG + Exonic
1083784411 11:64935487-64935509 ACGTGGGTGTGCAGGTGGGATGG + Intronic
1084544455 11:69807756-69807778 AAAAGGGTATGGGGGTGAGAGGG - Intergenic
1084610862 11:70202281-70202303 CCGTGGGTCTGGAGGTGAGGAGG - Intergenic
1085027480 11:73244992-73245014 GAGTGGGCCTGGAGGGGAGGAGG + Intergenic
1086049910 11:82577564-82577586 AAGCGGGGCTGGAGGGGAGGGGG + Intergenic
1086282014 11:85200791-85200813 GACTGGGGCTGGAGCTGAGAGGG - Intronic
1086386304 11:86312446-86312468 ATGTGTGTCTGCACGTGAGATGG + Intronic
1086638854 11:89126136-89126158 ATGTGTGGCTGGAGGTGAGCTGG + Intergenic
1086661826 11:89428470-89428492 ATGTGTGTCTGCATGTGAGATGG - Intronic
1086806319 11:91247257-91247279 ATGTGTGTGTGGAGGGGAGAAGG + Intergenic
1086929042 11:92672217-92672239 GAGTAGGTCTGGGGATGAGAAGG - Intronic
1087199654 11:95332768-95332790 AAGTGGTCATGGAGATGAGAAGG - Intergenic
1088645423 11:111913096-111913118 AAGTGTGTCTTGAGGTCAGCAGG - Intronic
1088814222 11:113410447-113410469 TAGGGGGACTGGAGGTGGGAGGG + Exonic
1089430976 11:118424224-118424246 AAGTGTGTTTGGAGGTGACGAGG - Intronic
1090942122 11:131396029-131396051 AAAGGGTTCTGGAGGTGAGCAGG + Intronic
1091381973 12:67486-67508 AAGTGGGTGTGAGGGAGAGACGG + Intronic
1091988942 12:4938798-4938820 AACTGGATGTGGAGGTGGGAAGG + Intergenic
1092078437 12:5692726-5692748 TAGGTGGTCTGGAGGTGTGATGG + Intronic
1092170335 12:6370372-6370394 AAGAGGGGCTAGAGGGGAGAGGG - Intronic
1092667033 12:10813240-10813262 AAGTGGGTCTAAAGCTGGGATGG + Intergenic
1092784180 12:12012876-12012898 AAGATGGTCTGGAGATGAAAGGG + Intergenic
1092933949 12:13342631-13342653 AAGAAGGTCTGAAGTTGAGAAGG - Intergenic
1093384237 12:18531524-18531546 AAGTGGGGAAGAAGGTGAGAGGG - Intronic
1093571430 12:20669953-20669975 ATGTGTGTCTGCACGTGAGATGG - Intronic
1093902406 12:24651042-24651064 AAGTGGGTGGGGTGGTGAGGGGG - Intergenic
1094146786 12:27236944-27236966 AAGGGGCTCTGGAGTTGGGATGG - Intergenic
1095111824 12:38303518-38303540 AAGTGTGTTTTGAGATGAGATGG + Intergenic
1095128003 12:38504851-38504873 AAGCAGGTCTGGAGGTTGGAAGG + Intergenic
1095370526 12:41461694-41461716 AATTGGGTCTAAAGGTGATATGG - Intronic
1095502578 12:42856623-42856645 AAGTGTGTCTTGAAGTGAGAAGG + Intergenic
1095705158 12:45228977-45228999 ACTTGGGTCTGGAGGGGAGAAGG + Intronic
1095814536 12:46406985-46407007 AAGTGGGTGGGGAGGGAAGATGG - Intergenic
1096271217 12:50167475-50167497 AAGTGGGCCGGGAGGAGAGATGG - Intronic
1096545802 12:52339463-52339485 GAGTGTGTCTGAAGGTGAGAGGG - Intergenic
1096874196 12:54614513-54614535 CAGTGGGGCTGGAGAAGAGAAGG + Intergenic
1096907250 12:54946889-54946911 AAGTCGGACTGGGTGTGAGAAGG + Intergenic
1097839085 12:64303430-64303452 ATGTGTGTGTGGAGGGGAGATGG - Intronic
1098052699 12:66471131-66471153 AAGTGGCTCTGGAGGTAAAAAGG + Intronic
1099312453 12:81044506-81044528 AAGTGGATTTGAGGGTGAGATGG - Intronic
1100494467 12:95111575-95111597 AAGTAGGACTGGAGATGAGTGGG - Intronic
1101333058 12:103772691-103772713 AAGGGGCTCTGGAGCTGGGATGG + Exonic
1102229605 12:111253304-111253326 AAGGGGGTCGGGAGGTGAGTCGG - Intronic
1102500176 12:113346706-113346728 ACGTGGGTCTGCATGTGATACGG + Intronic
1102583875 12:113909735-113909757 AAGTGGGTCTGGAGGTGAGAAGG - Intronic
1102815515 12:115862267-115862289 AAGTGAGGGTGGAGGAGAGAGGG + Intergenic
1103433256 12:120905256-120905278 AAGTGAATCTGGAGCTTAGATGG + Intergenic
1103437223 12:120936366-120936388 AAGTGGGGCTGGAGCTGGGGTGG - Intergenic
1103578866 12:121899509-121899531 ATGTGGAGCTAGAGGTGAGAAGG - Intronic
1103851508 12:123936575-123936597 AGGTTGGTCAGGAGGTGACAGGG + Exonic
1103878104 12:124144635-124144657 AAGTGGGTCTGAAAGAGAGAGGG - Intronic
1104204141 12:126620140-126620162 AAGTGGGTGTGGGGGTGAGGGGG + Intergenic
1104344789 12:127986266-127986288 AAGAGAGGCTGCAGGTGAGAAGG + Intergenic
1104379578 12:128295396-128295418 AAGTAGGTCTGAGGCTGAGAGGG - Intronic
1104772699 12:131373469-131373491 AAGTGGGAATGGAGATGTGAAGG - Intergenic
1104799108 12:131541296-131541318 AAGTGGGTGTGGATTTGAGTTGG - Intergenic
1105277937 13:18947113-18947135 CAGTGGGTGTGGAGCAGAGAGGG + Intergenic
1105959463 13:25317166-25317188 AAGTGAGACTAGAGATGAGAAGG + Intronic
1106482129 13:30144478-30144500 AGATGGGTGTGGAGGTGATAAGG - Intergenic
1106790621 13:33152062-33152084 AAGTGGGTCTGAATGTGACAGGG - Intronic
1108934298 13:55866919-55866941 AGGTGATTCTGGAGGTCAGAGGG - Intergenic
1109570339 13:64179883-64179905 AAGTGGGGGTGGAGGTGGGGAGG + Intergenic
1110290749 13:73804094-73804116 AAGTGAGTGAGGAGGTGAGATGG - Intronic
1110355733 13:74564831-74564853 AAATGTGTGTGGAGGTGAGTTGG - Intergenic
1111273326 13:85915676-85915698 ATGTGTGTCTGCATGTGAGATGG + Intergenic
1113207917 13:107940103-107940125 CAGTGGGTCTGGTGGTGATTTGG + Intergenic
1113218283 13:108068972-108068994 AAGTGGGTGGGGAGGTGAGGGGG - Intergenic
1113333192 13:109352033-109352055 GTGTGTGTGTGGAGGTGAGAGGG + Intergenic
1114215595 14:20655546-20655568 AAGTGGGTCTGGATCTCTGAGGG + Intergenic
1114412095 14:22510566-22510588 CACTGAGTCTGGAGGTGAGCTGG + Intergenic
1115351813 14:32403854-32403876 AAGTGAATTTGGTGGTGAGAAGG - Intronic
1115394945 14:32897831-32897853 ATGTGGCTCTGGAAGTGAGAGGG + Intergenic
1116214232 14:41990594-41990616 AGGGGGATCTGGAGGTGTGAAGG - Intergenic
1116384252 14:44311154-44311176 ATGTGTGTCTGCATGTGAGATGG - Intergenic
1116996693 14:51332173-51332195 AAGTGAGTCAGAAGGAGAGAGGG + Intergenic
1118104165 14:62638796-62638818 ATGTGTCTCTGCAGGTGAGATGG - Intergenic
1118180520 14:63488095-63488117 AAGTAGGTGTGTGGGTGAGATGG - Intronic
1118182593 14:63508094-63508116 AAGTGTGTGTGGGGGTGGGAAGG - Intronic
1118348189 14:64955006-64955028 AAGTGAGGGAGGAGGTGAGAAGG - Intronic
1118521108 14:66586275-66586297 ATGTGTGTCTGCATGTGAGATGG + Intronic
1118593693 14:67420022-67420044 AGGTGGTTCTGAAGGTGAGTTGG + Intergenic
1119417270 14:74480677-74480699 AAGTCTATCTGGGGGTGAGAGGG - Intronic
1119877449 14:78072952-78072974 AGGTGTGTGTGGAGGTGAGCAGG - Intergenic
1120224757 14:81778218-81778240 AAGGGGGTATGGTGGTGAAAGGG - Intergenic
1121227782 14:92334027-92334049 AAGTGGGTGAGGAGGTGCAATGG + Intronic
1122067411 14:99183507-99183529 AAGTGGGTCTGGAAGGAACATGG - Intronic
1122120578 14:99551431-99551453 AGGTGGGTGTGCAGGTGAGCAGG + Intronic
1122374531 14:101249142-101249164 ACGTGGGTTTGGAGGTGAGGAGG + Intergenic
1122606074 14:102948287-102948309 GGGTGGGTGTGGAGGTGAGACGG + Intronic
1122606092 14:102948324-102948346 GGGTGGGTTTGGAGGTGAGGGGG + Intronic
1122606166 14:102948499-102948521 TGGTGGGTGTGGAGGTGAGAGGG + Intronic
1122606239 14:102948677-102948699 GGGTGGGTGTGGAGGTGAGGGGG + Intronic
1122606250 14:102948707-102948729 GGGTGGGTGTGGAGGTGAGAGGG + Intronic
1122888593 14:104722604-104722626 CAGTGGGTCTGGGGGTGTCAAGG - Intergenic
1124801838 15:32840238-32840260 AAGGGGCTGTGGTGGTGAGAGGG + Intronic
1125176627 15:36830051-36830073 GAGTAAGTCTGGAGGTCAGAGGG + Intergenic
1126071468 15:44868383-44868405 ATGTGTGTCTGCATGTGAGATGG - Intergenic
1126204032 15:46021517-46021539 AAATGTGTGTGGATGTGAGAAGG + Intergenic
1126720305 15:51571039-51571061 ATGTGTGTCTGCATGTGAGATGG - Intronic
1127361389 15:58247650-58247672 AAGTCAGGCTGCAGGTGAGAGGG + Intronic
1128393981 15:67204793-67204815 TAGTGGGCCTGGAGTGGAGAAGG - Intronic
1128571420 15:68736239-68736261 AAGTGGGTGGGGCTGTGAGAAGG - Intergenic
1129123978 15:73422095-73422117 AAGTGGTGGTGGAGGTGAGAAGG + Intergenic
1129256889 15:74338850-74338872 GAGTGGGAGTGGTGGTGAGAGGG - Intronic
1129515637 15:76155418-76155440 GAGCAGGTCTGGAGGTGGGAGGG - Intronic
1130747350 15:86669832-86669854 AAGTGTGTGTGGAGGGGAGTGGG + Intronic
1130838267 15:87672941-87672963 AGGTGGGGCAGGAGGTGACAGGG - Intergenic
1131076388 15:89497709-89497731 AAGAGGGGCTGGAGGGGAGCAGG + Intergenic
1131635171 15:94225330-94225352 AAGTGTGACTGGAAGTCAGAAGG - Intergenic
1132008437 15:98252559-98252581 CAGTGGGCTTGGAGGTGTGAAGG - Intergenic
1132413642 15:101604748-101604770 ATGTGGGTCTGGAAGAGAGCTGG - Intergenic
1132698773 16:1213428-1213450 GAGTGGGTATGAAGCTGAGATGG - Intronic
1133923970 16:10179875-10179897 AAGTGGGGGTGGGGGTGGGAGGG - Intronic
1134013826 16:10874659-10874681 AACTGGGTCTGGAGGAGTCAGGG + Intergenic
1134117623 16:11561083-11561105 AGGTGGGTCTGGGGCTGTGACGG - Intronic
1135962544 16:27009719-27009741 AGGAGGGAGTGGAGGTGAGAGGG + Intergenic
1136371179 16:29837030-29837052 ACGTGCGTCTGGAGGAGAGAAGG - Intronic
1136851998 16:33619528-33619550 AAGGGTGCCTGGAGGAGAGAGGG + Intergenic
1137496086 16:48970420-48970442 AGGTGGGTCTGAAGGCGAGCGGG + Intergenic
1137612345 16:49827180-49827202 AAGTGGGTGATGAGGTCAGATGG - Intronic
1137627825 16:49920787-49920809 CAGTGGGTCTTGTGCTGAGAAGG + Intergenic
1140901579 16:79372810-79372832 CAGTGGGTCTGGAGCTGAGAGGG - Intergenic
1141454467 16:84130857-84130879 AAGTGGGTCTGGAGGAGGACTGG + Intronic
1141852029 16:86652990-86653012 CAGAGGGTCTGGAGGGAAGAAGG - Intergenic
1203113597 16_KI270728v1_random:1467996-1468018 AAGGGTGCCTGGAGGAGAGAGGG + Intergenic
1142502335 17:340060-340082 CAGTGGGTCTGGTGGGGAGCAGG - Intronic
1142872440 17:2829494-2829516 TAGAGGGGCTGGAGGTGAGCAGG - Intronic
1143624962 17:8104387-8104409 AAGTGGGTCAGGATAGGAGATGG + Intronic
1144502662 17:15802725-15802747 AAGGCTGTCAGGAGGTGAGATGG + Intergenic
1145164842 17:20605379-20605401 AAGGCTGTCAGGAGGTGAGATGG + Intergenic
1145868039 17:28253251-28253273 AACTGGCTCTGGGGTTGAGAGGG + Intergenic
1146290610 17:31604181-31604203 AAATGGGTCTGGATTTAAGAGGG - Intergenic
1147153682 17:38532656-38532678 AAGTGGGCCTGGAGTAGAGACGG - Exonic
1147301660 17:39533713-39533735 AAATGGGGGTGGGGGTGAGATGG - Exonic
1147334768 17:39720574-39720596 AAGGGGGTATGGAGAGGAGAGGG + Intronic
1147614310 17:41819403-41819425 AGGAGGGTCTTGAGGTGGGAGGG + Intronic
1147638073 17:41975988-41976010 AAATGGGTCTGGGGGTCAGGAGG + Exonic
1147644875 17:42027568-42027590 GACTGGGTCAGGAGGGGAGAGGG - Intronic
1148552380 17:48558238-48558260 AAGCGGGCCTGGAGCTGAGCTGG + Intronic
1152325633 17:79634261-79634283 CAGTGGCTCTGGCGGTGAGGTGG - Intergenic
1152380024 17:79937544-79937566 AGGAGGGTCTGAAGGTGGGAGGG - Exonic
1152932404 17:83116553-83116575 CAGTGGGACTGGAGTTGAGCTGG - Intergenic
1154166051 18:12015291-12015313 AAGTGGGTCAAGAGGGGAGGCGG - Intronic
1154406901 18:14100667-14100689 GAGTGGGTATGGTGGGGAGAAGG + Intronic
1155246924 18:23919671-23919693 AAGAAGGCCTGGAGGTGGGAAGG + Intronic
1156640236 18:39086272-39086294 TTGTGGGTGTGGAGGTGTGAAGG + Intergenic
1157995777 18:52553700-52553722 AAGGGGGTCTAGAGGAGAGTAGG + Intronic
1158196058 18:54886104-54886126 AAGTGGGTGTAGAAGTGATATGG - Intronic
1158423594 18:57319071-57319093 ATGTAGGTCTGGAGGCCAGAAGG - Intergenic
1158865820 18:61636804-61636826 AGCTTGGTCTGGAGGTGAGGAGG - Intergenic
1158898478 18:61938329-61938351 AAGTGGGAATGTAAGTGAGAGGG - Intergenic
1159997551 18:74980887-74980909 CAGTGTGTCTGGGGCTGAGAAGG - Intronic
1160175800 18:76593010-76593032 AAGTGGCTTTGCAGGGGAGACGG - Intergenic
1160185208 18:76671108-76671130 GAGTGGTTCTGGAGCTGAGATGG + Intergenic
1160294340 18:77623721-77623743 AGGTGGGTGTGCAGGTGAGAAGG + Intergenic
1160323283 18:77915898-77915920 AAGGGGTTCAGGGGGTGAGAGGG - Intergenic
1160677555 19:399477-399499 AAGGGGTTAGGGAGGTGAGAGGG + Intergenic
1161509128 19:4660927-4660949 AAGAGGGTCTGCTGTTGAGAGGG - Intronic
1161559018 19:4960530-4960552 AAGTGAGACTGAAGGTCAGAGGG + Intronic
1163374935 19:16924249-16924271 AAGTGGGTTTGGGGGGAAGATGG + Intronic
1163430479 19:17264213-17264235 ATCTGGGTGTGGAGGGGAGAGGG + Intronic
1163509021 19:17724459-17724481 GCGTGGGTCTGGAGGTGGGAAGG + Intronic
1165028885 19:32983018-32983040 AAGGGTGCCTGGAGGAGAGAGGG - Intronic
1165476014 19:36031547-36031569 AGGAGGGTATGGAGCTGAGAGGG - Intronic
1165830957 19:38729919-38729941 AAGTGAGTCTGGAGCAGAGAGGG - Exonic
1166009962 19:39934820-39934842 CAGCGGGTCTGGAGGTGGGTTGG + Intergenic
1166103876 19:40588200-40588222 ATGAGGGTATGGAGGTGACAAGG + Intronic
1166226577 19:41399409-41399431 AAGTGGGGCAGGAGGTGGGCAGG + Intronic
1167156374 19:47741633-47741655 ACGTGAGGCTGGAGGTGTGAAGG - Exonic
1168123822 19:54271891-54271913 AAGCGGGGCTGGGGGTGGGAGGG - Intronic
1168178535 19:54643644-54643666 AAGCGGGGCTGGGGGTGGGAGGG + Intronic
1168593652 19:57656412-57656434 AAGTGGTTGTGGATGTGGGAGGG - Intergenic
925000755 2:401091-401113 AAGAGGATCCGGAAGTGAGAAGG + Intergenic
925302255 2:2825766-2825788 AGGTGGGTCTGCTGGTGAGTTGG - Intergenic
925852723 2:8098671-8098693 AAGAGGATGTGGAGGTGAGGAGG - Intergenic
926746522 2:16163013-16163035 AAATGGATTTGGAGGTGGGAGGG - Intergenic
927455461 2:23245326-23245348 AAGTGTGTCTAAAGCTGAGAGGG - Intergenic
927500470 2:23579577-23579599 AAGTGGGACTGGAGGGAAAAGGG - Intronic
927514252 2:23662707-23662729 AGGTGGCTCGGGAGGTGAGCTGG - Intronic
927657071 2:24958206-24958228 GAGTGGAACTGGAGGTGGGACGG - Intronic
927674273 2:25093046-25093068 AAGTTTTTCTGGAGCTGAGAGGG - Exonic
927721778 2:25387729-25387751 TGCTGGGGCTGGAGGTGAGAAGG - Intronic
928129247 2:28637761-28637783 GAGTGGGCAAGGAGGTGAGAAGG - Intronic
928821841 2:35371039-35371061 ATGTGTGTCTGGAGGAGGGATGG + Intergenic
929774219 2:44918145-44918167 CAGTGGGTCTGGAGGTGAGATGG + Intergenic
929859890 2:45667743-45667765 AACTAGGTGTGGAGGTGAGGGGG - Intronic
930610794 2:53540754-53540776 AAGTAGTTCTGGAGCTGGGATGG + Intronic
931043836 2:58327578-58327600 ATGTGTGTCTGCACGTGAGATGG - Intergenic
932565458 2:72904277-72904299 AAGGTAGTCTGGGGGTGAGAAGG + Intergenic
933161227 2:79026844-79026866 ATGTGGGGTTGGAGGTGATAGGG + Intronic
933840741 2:86284009-86284031 AAGTAGGCCTGGGGGTGAGGGGG + Intronic
934048654 2:88191709-88191731 GAGTGGGGCTGGGGGTGAGGTGG - Intergenic
934942227 2:98510996-98511018 ATTTGTGTCTGCAGGTGAGAAGG + Intronic
936290631 2:111221073-111221095 ATTTGGGTGTGGGGGTGAGAGGG - Intergenic
937186564 2:120049553-120049575 ACGTGTCTCTGCAGGTGAGATGG + Intronic
938094974 2:128455667-128455689 AGGTGGGTCTGCAGGGTAGATGG + Intergenic
938567376 2:132531107-132531129 ATGTGTCTCTGCAGGTGAGATGG - Intronic
938579597 2:132634198-132634220 AGATGATTCTGGAGGTGAGATGG + Intronic
938867540 2:135438619-135438641 GATTGGGACTTGAGGTGAGAAGG - Intronic
938894721 2:135738591-135738613 CAGTGAGTGTGAAGGTGAGAAGG - Intergenic
939033498 2:137103637-137103659 ATGTGTGTCTGTATGTGAGATGG - Intronic
941809987 2:169745910-169745932 ATGTGGGTTTGCAGCTGAGAAGG + Intronic
944851108 2:203720154-203720176 GAGTGAGATTGGAGGTGAGAAGG - Intronic
945481340 2:210349436-210349458 ATGTGTGTCTGCACGTGAGATGG + Intergenic
945923452 2:215779669-215779691 AAGTGGGACTTGAGTTGAGCAGG - Intergenic
946305367 2:218854000-218854022 AAATGGGTCTGGAGCTCAGAGGG - Intergenic
946373816 2:219296585-219296607 AAGTGGGTCAGGGTCTGAGAAGG + Intronic
946711840 2:222514877-222514899 AAGTGGTTTTGAAGTTGAGAAGG - Intronic
947033731 2:225826827-225826849 ATGTGTGTCTGCACGTGAGATGG - Intergenic
947526416 2:230879258-230879280 GAGTGTGGCTGGAGGGGAGATGG + Intergenic
947763444 2:232620789-232620811 CACTGGGTCTGGAGATGAGCGGG - Intronic
948463838 2:238142940-238142962 AGGTGGGTCTGGACGCGGGAGGG - Intronic
948678247 2:239611735-239611757 CAGTGTGACTGGAGGTGTGATGG - Intergenic
948953312 2:241269387-241269409 ACATGGGTCCGGAGCTGAGAAGG + Intronic
1169276570 20:4237096-4237118 ATGTGGATCTGAAGGGGAGAGGG + Intronic
1169393801 20:5212470-5212492 AAAAGGGTGTGGAAGTGAGAAGG - Intergenic
1169681127 20:8215026-8215048 AAGTAGCTGTGGAGCTGAGAAGG - Intronic
1170316289 20:15044470-15044492 GAGTGGGTCTGGAGGGCAAATGG - Intronic
1170466172 20:16624237-16624259 AGGTGGGGCTGGAAGTGGGAGGG + Intergenic
1170827862 20:19811521-19811543 CAGTGGGTGTGGAGGGGACAAGG + Intergenic
1171057506 20:21921442-21921464 AAGTGGGTGGGGAGGTGGAAGGG + Intergenic
1171465995 20:25328404-25328426 GAGTGGGTCTAGATGTGGGATGG - Intronic
1172221331 20:33276967-33276989 ACCAGGGGCTGGAGGTGAGATGG - Intronic
1173014428 20:39212029-39212051 GATTGGGGGTGGAGGTGAGAGGG + Intergenic
1173014675 20:39214427-39214449 AAGTGGGTGTGAAGGGGGGAAGG + Intergenic
1173089368 20:39955632-39955654 GGCTGGGTCTGGAGGTGTGAAGG - Intergenic
1173198614 20:40937520-40937542 AACTGGATATGGAGGTGAGAGGG + Intergenic
1173976142 20:47188158-47188180 GAGGGGGTCTGAGGGTGAGATGG - Exonic
1174201853 20:48811934-48811956 AAGTGGGTCTGCGGTTGAGATGG - Intronic
1174473956 20:50782785-50782807 AAGGGTGTCTAGAGGTGAAATGG - Intergenic
1174560436 20:51427191-51427213 TGGTGGGTTTGGTGGTGAGATGG + Intronic
1174843656 20:53922447-53922469 AAGTGGGGGTGGAAATGAGAGGG - Intergenic
1175723863 20:61303654-61303676 CAATGGCGCTGGAGGTGAGAAGG - Intronic
1176024323 20:62978101-62978123 AAGTGCGCCAGGAGGGGAGATGG - Intergenic
1176283227 20:64327347-64327369 AAGTGGGTGTGAGGGAGAGACGG - Intergenic
1176946603 21:14989782-14989804 ATGTGTGTGTGGAGGTGAGGAGG + Intronic
1177907100 21:26985054-26985076 TAGTGGGTCTGGAGGTGCCTGGG - Intergenic
1179123941 21:38575064-38575086 CTGAGGCTCTGGAGGTGAGAGGG - Intronic
1180502106 22:15939344-15939366 ATGTGTCTCTGCAGGTGAGATGG - Intergenic
1180871424 22:19149273-19149295 CGGTGGGTCTGGACGCGAGATGG + Intronic
1181093359 22:20489396-20489418 AAGTTGGACTAGAGGTGGGAGGG - Intronic
1182072851 22:27475725-27475747 CAGTGTGTGGGGAGGTGAGAGGG + Intergenic
1183093335 22:35538444-35538466 AAGTGGGTGGGGAGGGGGGAAGG + Intergenic
1183265011 22:36819496-36819518 AAGTGAGCCTGGAGGTGGGATGG + Intergenic
1183914151 22:41103198-41103220 AAGTGGGTAGGCAGGTGTGATGG + Intronic
1184103574 22:42354389-42354411 AAGCGGGTGAGGAGGTGAGAAGG - Intergenic
1184110704 22:42392476-42392498 GAGAGGGGCTGAAGGTGAGAGGG + Intronic
1184721731 22:46318587-46318609 AAGATGGTCAGGAGGTGACACGG + Intronic
1184879341 22:47295165-47295187 AAGTGGATCTGGGGCTGAGGAGG - Intergenic
950090308 3:10290202-10290224 AGGTGGGCCTGGGGGAGAGAGGG + Exonic
952850028 3:37720203-37720225 AAGGGGGTTTGCAGGTGAGAAGG + Intronic
953218851 3:40949151-40949173 ACGTGTGTCTGCACGTGAGATGG + Intergenic
953229486 3:41051991-41052013 AAGTAGGTATGGAGGAGTGATGG - Intergenic
953556995 3:43953701-43953723 AAGTGTGTGTGGCGGTGGGAGGG + Intergenic
954375265 3:50191284-50191306 AGGTGGGGCTGGCAGTGAGAGGG - Intergenic
954978805 3:54724023-54724045 ATGTGTGTCTGCACGTGAGATGG - Intronic
955211698 3:56947381-56947403 ATGTGTCTCTGCAGGTGAGATGG - Intronic
955415841 3:58690101-58690123 AAGTGAGGGTGGAGGTGGGAGGG + Intergenic
957723140 3:84031064-84031086 AAGTGGGTCAGGATGGGGGAGGG + Intergenic
958624312 3:96605227-96605249 ATGTGTCTCTGCAGGTGAGATGG + Intergenic
959768198 3:110059104-110059126 AAGTGGGTCGGGGGGAGAAAGGG - Intergenic
960507671 3:118513165-118513187 AAGAGGGTCTTCAGGGGAGAAGG - Intergenic
961012889 3:123448054-123448076 AGGTGGGTCTGGAGGAGCGGCGG - Exonic
961537640 3:127579760-127579782 AAATGGGGCTGGAGGTGATGCGG + Exonic
961795426 3:129405351-129405373 AAGGGGCTGTGGAGGTGAGAAGG + Intronic
961871278 3:129990085-129990107 AAATGGGTCTGGAGGGCAAATGG + Intergenic
962836545 3:139194533-139194555 ATGTGTGTCTGCACGTGAGATGG + Intronic
963041906 3:141076283-141076305 AAGTGGGGCCGGACGTGAAAAGG - Intronic
963789361 3:149567882-149567904 AAGTGGGCATGGAAGTGGGATGG - Intronic
964658367 3:159093082-159093104 AAGAAGGTATGGAGGTGAAAAGG - Intronic
966567872 3:181403277-181403299 AAATGAGCCTGGAGGGGAGAGGG + Intergenic
966751251 3:183324194-183324216 GAGGGGATCTGGAGGTGACAGGG + Intronic
967313315 3:188127127-188127149 AGGTGGGGCTGGAGGTGACAGGG - Intergenic
968088820 3:195886944-195886966 AGGTGGGTGAGGAGGTGGGAGGG - Intronic
968733116 4:2281036-2281058 AAGGGTGTCTGGGGTTGAGATGG - Intronic
969329005 4:6462095-6462117 AAGGGGTCCTGGAGGAGAGAGGG + Intronic
970294283 4:14611932-14611954 AAGAAGGTCTGGAGTTGAAATGG + Intergenic
972249165 4:37281040-37281062 GAGTGGGTCTGGAGGGGCAAAGG + Intronic
973166597 4:47085823-47085845 AAGAGCATCTGGAGGTGACAGGG - Intronic
973547148 4:51993320-51993342 ATGTGAGTCTGGAGCTTAGATGG + Intergenic
975232375 4:71949808-71949830 ATGTGTCTCTGCAGGTGAGATGG - Intergenic
975957539 4:79859269-79859291 GAGTGGGAAAGGAGGTGAGAGGG - Intergenic
976609784 4:87018499-87018521 AAGTGGTGATGGTGGTGAGAAGG + Intronic
976861170 4:89668840-89668862 AGGTGGGACTGGGGGTGGGATGG - Intergenic
978100514 4:104834738-104834760 GAGGGGGTTGGGAGGTGAGATGG - Intergenic
978555971 4:109980777-109980799 AAGTGGGTTTGAAGATGAAAAGG - Intronic
979099900 4:116600110-116600132 AAGTGAGTCTGGAGCAGGGAGGG - Intergenic
980216256 4:129856021-129856043 ATGTGTCTCTGCAGGTGAGATGG - Intergenic
980532859 4:134076724-134076746 ATGTGGGTCTGGAGCTTTGAGGG + Intergenic
980844984 4:138313400-138313422 AAGTGAGAGTGGGGGTGAGATGG + Intergenic
983299748 4:165909851-165909873 AACTGAGACTAGAGGTGAGAGGG + Intronic
984949298 4:184994816-184994838 GAGTGTGTCTGGAGGTCAGGAGG + Intergenic
984981615 4:185287433-185287455 CAGTGGGGCTGCAGGGGAGAGGG + Intronic
985266060 4:188153832-188153854 AAGTGAGAGTGGGGGTGAGAAGG + Intergenic
985624441 5:977657-977679 AAGAGGGGCTGCAGGTGAGGTGG - Intergenic
986221861 5:5775543-5775565 GTGTGGGCCTGGAGGTAAGAGGG + Intergenic
988516412 5:31908452-31908474 AAGATGGTCTGTAGGAGAGAGGG + Intronic
988687537 5:33539581-33539603 CTGTGGGTCTTGAGTTGAGAAGG - Intronic
989378402 5:40789631-40789653 AAGTGGGGCTGGAGGGGAAAAGG + Intronic
990266724 5:54084630-54084652 ATCTGGCTCTGGAGGGGAGATGG - Intronic
992896344 5:81248413-81248435 AAGTGGGTTTGAGGGTGTGATGG + Intronic
994309190 5:98247628-98247650 AAGTGGCTCTTGAGGTGGGTAGG - Intergenic
994383718 5:99102807-99102829 AAGTGGATCTAGCGGTGGGAAGG + Intergenic
995314542 5:110753176-110753198 AAGTGGGTTCAGAGGTGAGTGGG + Intronic
995655206 5:114418568-114418590 AAGTGGGGCTGGCGGGGAGTTGG + Intronic
996266348 5:121545556-121545578 AGATGGGGCTGGAGGTGGGAAGG - Intergenic
999054320 5:148557484-148557506 ATGTGTGTCTGGAGCTCAGAGGG + Intronic
999106230 5:149073600-149073622 AAATGGGTTTGGAGGAGATAAGG - Intergenic
999141474 5:149365253-149365275 ATGTGGGTCTGGAAGTGAAGAGG - Intronic
999394332 5:151217400-151217422 ACTTGGGGCTGGGGGTGAGAGGG + Intronic
999561403 5:152807532-152807554 AAGTGCTGCTGGAGGAGAGAAGG - Intergenic
999837602 5:155391485-155391507 TATGGGGTCTGGTGGTGAGAGGG - Intergenic
1001141341 5:169146536-169146558 AAGGGGGTGTGGAGGTCAGAAGG - Intronic
1001322594 5:170695129-170695151 AAGGGGATCGGGAGGTGACAAGG - Intronic
1001905980 5:175473618-175473640 AAGGGGGTGTGGGGGTGACAGGG - Intergenic
1002317262 5:178351186-178351208 AACTGGCTCTGGAGGTGAGCAGG + Intronic
1002639381 5:180623487-180623509 AAGAGGCTCTGGAGGTGTGTAGG + Intronic
1003317329 6:5024466-5024488 CAGAGGCTCTGGAGGAGAGAGGG + Intergenic
1003377777 6:5595068-5595090 AAGGGGGTTTGGAGCTGAGAGGG + Intronic
1003966676 6:11258663-11258685 AAGTGAGTGTGAAGCTGAGAGGG + Intronic
1004585376 6:16994646-16994668 GAGTGGGTCAGGAGGTAAGCAGG + Intergenic
1005825516 6:29629263-29629285 AGGTGGGTCTGGGGGTAAGGGGG + Intronic
1005923264 6:30418751-30418773 AAGTGCCTCTGTAGGTGAGGAGG + Intergenic
1006486805 6:34349533-34349555 ATGTGGGACTGGAGTTAAGAGGG + Intronic
1006568236 6:34978258-34978280 AAGTGGGTCTTAAGATGAGTAGG + Intronic
1006615102 6:35320961-35320983 AATTGAGCCTGGAGGTGAGAAGG + Exonic
1006994439 6:38245344-38245366 AAGTGGCCCTTGAGCTGAGAAGG + Intronic
1007182027 6:39935820-39935842 AACTGGGTATGGGGGAGAGAAGG + Intergenic
1007342759 6:41201980-41202002 AAGGGGGTCTTGAGATGAGGTGG - Intergenic
1007598153 6:43064599-43064621 GAGTGGGTTAGGAGTTGAGATGG + Intronic
1008972452 6:57385552-57385574 AATGGGGTCTGGAGGTTAGATGG - Intronic
1009161360 6:60287079-60287101 AATGGGGTCTGGAGGATAGATGG - Intergenic
1009339522 6:62536563-62536585 AAGTAGCTCTGTAGGTGAGGTGG + Intergenic
1010390252 6:75328832-75328854 AGCTGAGACTGGAGGTGAGAGGG - Intronic
1013598371 6:111681607-111681629 AGGTGGGACTGGAGCTGAGGAGG - Intronic
1013874167 6:114803796-114803818 GTGTGTGTCTGCAGGTGAGATGG + Intergenic
1014080114 6:117276095-117276117 ATTTGGGTCTGGATGGGAGATGG + Intergenic
1016655430 6:146513545-146513567 AGATGGGTCTGCACGTGAGATGG + Intergenic
1017358784 6:153541994-153542016 AGGTGGGAATGGAGGTGAGCAGG - Intergenic
1017715844 6:157212421-157212443 TGGTGGGGCTGGAGGTGGGAGGG + Intergenic
1017750135 6:157483675-157483697 AAGTGGCTCAGGAGGTTTGACGG + Intronic
1018797244 6:167196109-167196131 AAGTGGCCCCGGAGGTGACAGGG - Intronic
1018819053 6:167358655-167358677 AAGTGGCCCCGGAGGTGACAGGG + Intronic
1019430640 7:997426-997448 AGGAGGGTCTGGAGGAGGGAAGG + Exonic
1019519103 7:1452660-1452682 CTGTGGGTCTGGGGGTGAGATGG - Intronic
1020331299 7:7019730-7019752 AAATGACTCTGGAGGTGACAAGG + Intergenic
1020640629 7:10749324-10749346 ATGTGTGTCTGCACGTGAGATGG - Intergenic
1022801285 7:33779793-33779815 AAGTGGATGGGGAGGAGAGAAGG - Intergenic
1023020823 7:36010444-36010466 AGTTGGTTCCGGAGGTGAGAAGG - Intergenic
1023863290 7:44227632-44227654 AGGAGGGTCTGGAGGACAGAGGG + Intronic
1024042638 7:45567167-45567189 AAGTGGGTGTGGGGGTGGGCTGG + Intergenic
1024447126 7:49493810-49493832 AAGAGGATCTGGAGGCCAGAAGG + Intergenic
1027917312 7:84341932-84341954 TAATTGGTTTGGAGGTGAGAAGG - Intronic
1028079954 7:86563149-86563171 AAGAGGGTTTGGTGGTGAGGAGG - Intergenic
1028162220 7:87498584-87498606 AAGTGGATCTTGAGGTGGCAAGG + Intergenic
1028718776 7:94004700-94004722 AATCGTCTCTGGAGGTGAGAGGG - Intergenic
1029177378 7:98674661-98674683 AAGTGGGTGGGGTGGGGAGAGGG - Intergenic
1029905864 7:104093021-104093043 CAGTGGGGCTGGAGGAGACAAGG + Intergenic
1030316780 7:108123975-108123997 CAGTGGGTCTGGAGAAAAGAAGG + Intronic
1030383193 7:108836797-108836819 AAATGGCTCTGGAGGTGGGTAGG + Intergenic
1031803486 7:126278063-126278085 ATGTGTGTCTGCACGTGAGATGG + Intergenic
1032368490 7:131323292-131323314 AGGAGGGTCTGGAGGTGAAAGGG + Intronic
1032427371 7:131832710-131832732 AAGTGGGTGAGGAGAAGAGATGG - Intergenic
1033222300 7:139536216-139536238 CAGTGGGACTGGCGGTGGGATGG + Intronic
1034077760 7:148249230-148249252 CAGTGGGTTTGGTGGTGAGAAGG - Intronic
1034282947 7:149866195-149866217 CTGTGGGTCTGGCGGTCAGAGGG + Exonic
1034355163 7:150445440-150445462 GAGTGGGTGGGGAGGGGAGAGGG + Intergenic
1034440096 7:151081892-151081914 AACTGGGTCCTGAGGAGAGAGGG + Exonic
1035390230 7:158499119-158499141 AAGGGGGTCTTGAGATGATAAGG - Intronic
1037590357 8:20306718-20306740 GAGTGGGGCTGGAAATGAGAAGG + Intergenic
1038495511 8:27999391-27999413 AGGTGGGCATGGGGGTGAGAGGG - Intergenic
1038611599 8:29064380-29064402 AACTGGGGCTGGAGGTGTGGGGG - Intronic
1039899187 8:41738799-41738821 AAGTGGCTGTGAAGGTGAGATGG - Intronic
1040982425 8:53257253-53257275 AAGTGGGTCTGGAGGACAAGTGG + Intergenic
1041944020 8:63421873-63421895 AAGTGGTAATGGTGGTGAGAGGG - Intergenic
1042332327 8:67593771-67593793 ATGTGTGTCTGCACGTGAGATGG + Intronic
1042394719 8:68278539-68278561 ATGTGTGTCTGCACGTGAGATGG - Intergenic
1042540903 8:69906231-69906253 AAGTGGGTTTGGAGATGAGTCGG - Intergenic
1044150561 8:88771247-88771269 AATTGGATCTTGAGGTGGGAGGG + Intergenic
1046828805 8:118721604-118721626 ATGTGTGTCTGCACGTGAGATGG + Intergenic
1047140981 8:122139314-122139336 AAGGGGGTCTGGTGATGAGCAGG + Intergenic
1047536675 8:125726469-125726491 GAGAGTGGCTGGAGGTGAGATGG + Intergenic
1048464488 8:134654405-134654427 AAGTCAGTCTGGAGGAGATAAGG + Intronic
1049702438 8:144021284-144021306 AAGAGGGTCCTGAGGGGAGAGGG - Intronic
1049702512 8:144021589-144021611 CAGAGGGTCCTGAGGTGAGAGGG - Intronic
1049702645 8:144022118-144022140 AAGAGGGTCCTGAGGGGAGAGGG - Intronic
1049702719 8:144022436-144022458 CAGAGGGTCCTGAGGTGAGAGGG - Intronic
1049702858 8:144022998-144023020 AAGAGGGTCTTGAGGGAAGAGGG - Intronic
1049702884 8:144023078-144023100 AAGAGGGTCCTGAGGAGAGAGGG - Intronic
1049703392 8:144024911-144024933 AAGAGGGTCCTGAGGGGAGAGGG - Intronic
1049703423 8:144025023-144025045 GAGAGGGTCCTGAGGTGAGATGG - Intronic
1049845212 8:144797485-144797507 AAGTGTGTGTGGAGGTGAGTGGG + Intergenic
1050308156 9:4327148-4327170 CAGTTGGTGTAGAGGTGAGAAGG + Intronic
1051828075 9:21243690-21243712 ACCTGGGTCAGGAGGAGAGAAGG - Intergenic
1052261030 9:26516415-26516437 AAACAAGTCTGGAGGTGAGAGGG + Intergenic
1052513669 9:29452825-29452847 ATGTGTGTCTGCATGTGAGATGG - Intergenic
1052717173 9:32130749-32130771 ATGTGTGTCTGCATGTGAGATGG - Intergenic
1052853153 9:33390374-33390396 TAATGGGTCTGGTGGTGAGAGGG + Intronic
1053202921 9:36164994-36165016 AGTTGGGTCTGGAGGTGTCATGG - Intergenic
1053681191 9:40486548-40486570 TAATGGGTCTGGTGGTAAGAGGG + Intergenic
1053931180 9:43114872-43114894 TAATGGGTCTGGTGGTAAGAGGG + Intergenic
1054282523 9:63138386-63138408 TAATGGGTCTGGTGGTAAGAGGG - Intergenic
1054392300 9:64626552-64626574 TAATGGGTCTGGTGGTAAGAGGG + Intergenic
1054426948 9:65131763-65131785 TAATGGGTCTGGTGGTAAGAGGG + Intergenic
1054503427 9:65889777-65889799 TAATGGGTCTGGTGGTAAGAGGG - Intronic
1054729295 9:68684640-68684662 GAGTGAGTCTGGAGTTCAGAGGG + Intergenic
1055369185 9:75578671-75578693 AAGGGGATCTGGATGTGAGGGGG + Intergenic
1055510563 9:76992076-76992098 CACTGGGTCTGGCGGTGTGAAGG - Intergenic
1056805792 9:89727616-89727638 AGGGGGGTGTGGAGGGGAGATGG + Intergenic
1057041054 9:91847618-91847640 AAGCGGCTCTGGAGGAGAGCTGG - Intronic
1059014961 9:110505542-110505564 AACAGGGACTGGAGGTGAGGAGG + Intronic
1059059023 9:111015394-111015416 CAGTGGGTTTGGAGGGAAGAAGG - Intronic
1060200474 9:121649392-121649414 GAGTGTGTGTGGAGGGGAGAGGG - Intronic
1060282636 9:122224642-122224664 ACTAGGATCTGGAGGTGAGAGGG - Intronic
1060416882 9:123437047-123437069 AAGTGGGCCTGGAGATGAAGAGG + Intronic
1061397174 9:130349522-130349544 AGGAGGGGCTGGGGGTGAGAAGG - Intronic
1061666367 9:132162824-132162846 GAGGGGGTCGGGAGGTGAGGGGG + Intronic
1062092011 9:134683276-134683298 CAGAAGGTTTGGAGGTGAGACGG - Intronic
1062093180 9:134689255-134689277 CAGAAGGTTTGGAGGTGAGATGG - Intronic
1062310984 9:135937095-135937117 AAGTGTCTCTGGAGCTGCGATGG - Intronic
1186122406 X:6377912-6377934 TAGTGGGGGTGGTGGTGAGAGGG + Intergenic
1186562721 X:10630230-10630252 AAGTAGGTCTGATGGTGATAGGG + Intronic
1186654917 X:11601992-11602014 CTGTGTGTATGGAGGTGAGAGGG + Intronic
1186711832 X:12205904-12205926 AAGGGGCTTTGGAGTTGAGAAGG + Intronic
1186820399 X:13282356-13282378 TAGTTGGTCTGGGGGTGATAGGG - Intergenic
1186926642 X:14340315-14340337 ACGAGGGTGTGGAGGTGGGAGGG - Intergenic
1187286307 X:17907168-17907190 AAGTGGGAGTGGAGGGGTGAGGG - Intergenic
1189865545 X:45323532-45323554 ATTTGGGTCTGCAGGTGGGAGGG - Intergenic
1190598201 X:52066826-52066848 AAGGGGGTGTGGAGGTGGCAGGG + Intronic
1190610623 X:52187247-52187269 AAGGGGGTGTGGAGGTGGCAGGG - Intronic
1191959601 X:66686100-66686122 AACAGGGTCTGGAGGTGGCAGGG + Intergenic
1192207077 X:69103478-69103500 GAGTGGGGGTGGAGGTGGGATGG - Intergenic
1192733792 X:73828944-73828966 AAGTGGGGCTAAATGTGAGATGG - Intergenic
1192878825 X:75260357-75260379 ATGTGCGTCTGCACGTGAGATGG - Intergenic
1193034694 X:76936479-76936501 ATGTGTGTCTGCACGTGAGATGG - Intergenic
1193315855 X:80064433-80064455 ATGTGTCTCTGCAGGTGAGATGG + Intergenic
1194682616 X:96872242-96872264 AAGTGGGTGGGGAGGGGAAATGG - Intronic
1196858184 X:120002644-120002666 AAGTGTGTCTGGCCATGAGAAGG - Intergenic
1196946355 X:120830946-120830968 ATGTGTGTCTGCATGTGAGATGG + Intergenic
1198436718 X:136624342-136624364 AACTGGTAGTGGAGGTGAGACGG - Intergenic
1199353584 X:146833925-146833947 AAGGGGATCTGGAGGTCTGAAGG + Intergenic
1199621571 X:149706064-149706086 AAATGGGACTGGAGGTGAGCTGG - Intronic
1200111926 X:153744784-153744806 CTGTGGGTCTCGAGGAGAGATGG + Intergenic
1200358229 X:155574404-155574426 AAGTGGATCTGCATGTGGGATGG - Intronic
1200397326 X:155998941-155998963 CTGGGAGTCTGGAGGTGAGACGG - Intronic
1200581210 Y:4952802-4952824 ATGTGTGTCTGCACGTGAGATGG + Intergenic
1201284987 Y:12371131-12371153 CAGGTGGTCTGGATGTGAGATGG + Intergenic
1202389136 Y:24351946-24351968 AATAGGCTCTGGAGGGGAGATGG + Intergenic
1202481651 Y:25318178-25318200 AATAGGCTCTGGAGGGGAGATGG - Intergenic