ID: 1102585547

View in Genome Browser
Species Human (GRCh38)
Location 12:113920312-113920334
Sequence ACGTGGGCCCCTCTTTCTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 97
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 89}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102585547_1102585554 11 Left 1102585547 12:113920312-113920334 CCACCAGAAAGAGGGGCCCACGT 0: 1
1: 0
2: 0
3: 7
4: 89
Right 1102585554 12:113920346-113920368 CCCAGGCCTACCACCACCCCTGG 0: 1
1: 0
2: 4
3: 73
4: 680
1102585547_1102585558 22 Left 1102585547 12:113920312-113920334 CCACCAGAAAGAGGGGCCCACGT 0: 1
1: 0
2: 0
3: 7
4: 89
Right 1102585558 12:113920357-113920379 CACCACCCCTGGCTCACGTCAGG 0: 1
1: 0
2: 0
3: 15
4: 250
1102585547_1102585551 -6 Left 1102585547 12:113920312-113920334 CCACCAGAAAGAGGGGCCCACGT 0: 1
1: 0
2: 0
3: 7
4: 89
Right 1102585551 12:113920329-113920351 CCACGTGAGCAACCTCTCCCAGG 0: 1
1: 0
2: 0
3: 4
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102585547 Original CRISPR ACGTGGGCCCCTCTTTCTGG TGG (reversed) Intronic
907683409 1:56586133-56586155 ATATGGCACCCTCTTTCTGGTGG - Intronic
912607715 1:111009215-111009237 ACGTAGTCCCATATTTCTGGAGG - Intergenic
915430138 1:155860099-155860121 ATGTGAACCCCTCCTTCTGGGGG + Intronic
920263103 1:204703093-204703115 ACCTGTGCCCCTTTCTCTGGAGG + Intergenic
920398707 1:205663917-205663939 ACAGGGGCCCCTCTTCCTGGGGG + Intronic
923792567 1:237124758-237124780 ATGTGGGCCCTTTTTTTTGGTGG + Intronic
1065749330 10:28871214-28871236 ACTAGGGTCCCTCCTTCTGGGGG + Intronic
1068901115 10:62269698-62269720 ACATGGGCACCTATTTATGGAGG - Intergenic
1069368727 10:67721320-67721342 ACATGGTCCCATATTTCTGGAGG + Intergenic
1074699971 10:116084095-116084117 CCGTGGGCCCCTCTTTGTGTGGG - Intronic
1078317842 11:10306798-10306820 GCAAGGGCCCCTCCTTCTGGGGG + Exonic
1080047914 11:27828453-27828475 ACATGTTCCCATCTTTCTGGGGG - Intergenic
1081835514 11:46150110-46150132 GCGTGGGCTCCTTCTTCTGGGGG + Intergenic
1082748953 11:56997641-56997663 ACCTGGGCCCCCCTTACTGATGG + Intergenic
1083578963 11:63813209-63813231 ACGCGGGCCCCTCAGTCTGCGGG - Intergenic
1087241736 11:95789235-95789257 TCGGGGACCCCTTTTTCTGGGGG - Intronic
1101290182 12:103360371-103360393 AAGTGAGTCCCTCATTCTGGAGG + Intronic
1102220640 12:111192044-111192066 GCGTGGGCCTCTATTGCTGGTGG - Intronic
1102226120 12:111229473-111229495 ACCTGGGCCCATCTTTCTCCTGG - Intronic
1102585547 12:113920312-113920334 ACGTGGGCCCCTCTTTCTGGTGG - Intronic
1103593018 12:122005610-122005632 ACCTGGGAACCTCTTTCTGCAGG + Intergenic
1104792852 12:131494425-131494447 CCCTGGGCCCCTCCTTCTGCTGG - Intergenic
1112885355 13:104163620-104163642 ACGTGGTCCCTGATTTCTGGTGG - Intergenic
1119080200 14:71685567-71685589 ATGTTGGCGGCTCTTTCTGGAGG - Exonic
1119424336 14:74526054-74526076 AGGTGAGTCCCTCTTCCTGGCGG - Exonic
1119774791 14:77241504-77241526 AGGGGGGCTCTTCTTTCTGGGGG + Intronic
1122129626 14:99597557-99597579 ACCTGGGCCACTCTTGCTTGTGG + Intronic
1122572678 14:102717969-102717991 ACTTGGGCCACTTGTTCTGGAGG + Intronic
1129091145 15:73152310-73152332 AGGTGGGCCCCTCTTTGGGAAGG - Intronic
1129706170 15:77795858-77795880 TCATGGGGCCATCTTTCTGGGGG - Intronic
1131048699 15:89332926-89332948 ATGTGGGACTCACTTTCTGGTGG - Intronic
1137364489 16:47848978-47849000 AGGAGGGTCTCTCTTTCTGGAGG - Intergenic
1137755587 16:50899577-50899599 CCGTGGGCCTCTCTTTCTGAGGG + Intergenic
1142638643 17:1272273-1272295 AAGTCGGCCCCTCATTATGGGGG - Intergenic
1143119862 17:4599898-4599920 ACGTGGGCCCCGCCTCCCGGTGG + Intronic
1144509231 17:15860972-15860994 TCGTGGTTCCCTCTTTCTTGGGG - Intergenic
1145173349 17:20678617-20678639 TCGTGGTTCCCTCTTTCTTGGGG - Intergenic
1147585587 17:41652552-41652574 CCCTTGGCTCCTCTTTCTGGGGG - Intergenic
1148484622 17:47982651-47982673 GCCTGGTCACCTCTTTCTGGGGG + Intergenic
1154009977 18:10565813-10565835 AGATGGGTCCCTGTTTCTGGGGG - Intergenic
1160761082 19:784830-784852 GCGTTGGCCCCTCATTCTGCTGG - Intergenic
1162406779 19:10479577-10479599 ACATCATCCCCTCTTTCTGGCGG + Intergenic
1162721377 19:12664881-12664903 ACTTGGGCTGCGCTTTCTGGAGG - Exonic
1167049190 19:47068304-47068326 CTGTGGGCACCTCTTTCTGGAGG + Intronic
1168721976 19:58559156-58559178 ACGTGGGCCGCTTTTGCTCGCGG + Intergenic
925190169 2:1876226-1876248 CTGTGGGCCCCTCTCGCTGGGGG + Intronic
925292135 2:2755093-2755115 AAGTGGGCCACCCTTCCTGGGGG + Intergenic
928025747 2:27737078-27737100 ACATGGGCACCTCTGTGTGGGGG + Intergenic
1170270592 20:14523255-14523277 ACCAGGGCCCCTCTGTCTGCTGG - Intronic
1172163585 20:32885288-32885310 ACGTGGGGCCCTTTTTCTTTTGG + Intronic
1179117644 21:38508774-38508796 ACGTGGACCTCACTTTCTGATGG - Intronic
1181163079 22:20968954-20968976 AAGTGGGTCCCTCTGCCTGGTGG - Intronic
953988070 3:47460964-47460986 ACCTGGGCCCCTTTTCCTTGGGG + Intronic
955484766 3:59424327-59424349 AAGTGGGTCCCTCGTTCTGATGG + Intergenic
956323912 3:68029217-68029239 ACATGGACACATCTTTCTGGAGG + Intronic
958975642 3:100665509-100665531 ACTTGGGCACCTTTTTCTAGTGG + Intronic
966076144 3:175937825-175937847 AGGTGGGCTCCTGTGTCTGGCGG + Intergenic
967976096 3:195035547-195035569 ATTTGGGCCCCAGTTTCTGGCGG - Intergenic
968609775 4:1551707-1551729 GCTTGGGACCCTCTGTCTGGGGG - Intergenic
968609854 4:1552031-1552053 GCTTGGGACCCTCTGTCTGGGGG - Intergenic
970983107 4:22124479-22124501 ACGTAGTCCCATATTTCTGGAGG - Intergenic
971379396 4:26083243-26083265 GTGGGGGCCCCGCTTTCTGGTGG + Intergenic
978236762 4:106470232-106470254 ACATGGTCCCATATTTCTGGGGG + Intergenic
978972504 4:114827192-114827214 ACGTAGTCCCCTCTTACAGGAGG + Intergenic
983626572 4:169807606-169807628 AGGTCACCCCCTCTTTCTGGGGG - Intergenic
986713045 5:10501670-10501692 CTGTGGGCCCCACTGTCTGGAGG + Intergenic
987530576 5:19113967-19113989 ACATGGACTCCTGTTTCTGGTGG + Intergenic
991014327 5:61915249-61915271 GCCTGGTCCCCTCTTTCTAGAGG + Intergenic
997434689 5:133865805-133865827 ACAAGGGTCCCCCTTTCTGGTGG + Intergenic
998228215 5:140342988-140343010 CCGAGGTTCCCTCTTTCTGGTGG - Intronic
1001075104 5:168620684-168620706 AGGTCCTCCCCTCTTTCTGGAGG + Intergenic
1003879909 6:10470715-10470737 CAGTGGGCCTCTCTTCCTGGAGG + Intergenic
1019049752 6:169173857-169173879 ACGTGGGCCTCCCCATCTGGAGG - Intergenic
1019860007 7:3649394-3649416 TCGTGGGCCCCTCCTGCTGTTGG + Intronic
1023273468 7:38492382-38492404 ACTTGGGCCCCTCATACTTGTGG + Intronic
1029471191 7:100755296-100755318 CTGTGGGCCCCTCTGTCGGGAGG + Exonic
1035774163 8:2174416-2174438 CCCTGGGCCCCTCTTCCAGGAGG - Intergenic
1036287118 8:7452751-7452773 ACGTGGGCCTATGTTTCTGTTGG - Intronic
1036334363 8:7858771-7858793 ACGTGGGCCTATGTTTCTGTTGG + Intronic
1042156054 8:65844933-65844955 ACGATGGCCCCTCTCTGTGGTGG - Intergenic
1043122992 8:76353785-76353807 AAGTGGCCACCTCTTTGTGGGGG + Intergenic
1044837632 8:96311867-96311889 ATGTGGGCCCCTCCTTCTAAAGG + Intronic
1044881537 8:96728056-96728078 AGGTGTGCCCCTCTCTCTGGAGG + Intronic
1045034910 8:98169363-98169385 ATGTTAGACCCTCTTTCTGGGGG - Intergenic
1046631474 8:116626543-116626565 ACGTGGGCCTCTCGTCCTGGGGG - Intergenic
1052830314 9:33209896-33209918 ACGTGGGCATATCTTTTTGGGGG + Intergenic
1057217450 9:93236883-93236905 ACGAGGGCCCCTGTTCCAGGAGG - Intronic
1057223402 9:93270188-93270210 AGGTGGGCTCCTCTCTCTGCAGG - Intronic
1057493089 9:95537880-95537902 CCCAGGGCCCCTCTTTTTGGTGG + Intergenic
1061968925 9:134033095-134033117 ACGCGGCCACCTCTTTCTGGAGG - Exonic
1062487587 9:136787695-136787717 TCTTGGGCCCCTCTTCCAGGTGG + Intergenic
1190366053 X:49695784-49695806 CGGTGGGCCCCTCGGTCTGGTGG - Intronic
1190423538 X:50310224-50310246 AAGTGGGTCCCTCTTCCAGGAGG + Exonic
1199998014 X:153038940-153038962 CTGTGGGCCACTCTTTCTGAAGG - Intergenic
1200969965 Y:9141347-9141369 ATGTGGGCCCATATTTCTGATGG + Intergenic
1202141037 Y:21722899-21722921 ATGTGGGCCCATATTTCTGCTGG - Intergenic
1202145828 Y:21780899-21780921 ATGTGGGCCCATATTTCTGCTGG + Intergenic