ID: 1102585592

View in Genome Browser
Species Human (GRCh38)
Location 12:113920565-113920587
Sequence GGGCCACGGAGGCACTTGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 206
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 191}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102585592_1102585598 4 Left 1102585592 12:113920565-113920587 CCTGCCAAGTGCCTCCGTGGCCC 0: 1
1: 0
2: 0
3: 14
4: 191
Right 1102585598 12:113920592-113920614 CTGAGAATCTTCACTTTACCTGG 0: 1
1: 0
2: 0
3: 16
4: 181
1102585592_1102585600 25 Left 1102585592 12:113920565-113920587 CCTGCCAAGTGCCTCCGTGGCCC 0: 1
1: 0
2: 0
3: 14
4: 191
Right 1102585600 12:113920613-113920635 GGAGCTGCTTGAGAGCTTTCTGG 0: 1
1: 0
2: 2
3: 19
4: 145
1102585592_1102585601 26 Left 1102585592 12:113920565-113920587 CCTGCCAAGTGCCTCCGTGGCCC 0: 1
1: 0
2: 0
3: 14
4: 191
Right 1102585601 12:113920614-113920636 GAGCTGCTTGAGAGCTTTCTGGG 0: 1
1: 0
2: 1
3: 12
4: 139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102585592 Original CRISPR GGGCCACGGAGGCACTTGGC AGG (reversed) Intronic
900535165 1:3173485-3173507 GGGCCACGGAGGCCTCTGTCGGG - Intronic
902911681 1:19603031-19603053 GGGTCACAGAAGCACTAGGCCGG + Intronic
904620124 1:31770180-31770202 GGCCCACAGAGGGGCTTGGCTGG - Intergenic
907284771 1:53372596-53372618 GGGCCCCTGAGACAGTTGGCTGG - Intergenic
909066154 1:70938595-70938617 GGACTACGGTGGCACATGGCTGG + Intronic
912020532 1:105103799-105103821 GGGCCACAGGGGCAGTTGGCAGG - Intergenic
914327468 1:146634460-146634482 GGGGCACTGAGGCACTGGCCTGG + Intergenic
914681851 1:149944239-149944261 GAACCCCGGAGGCAGTTGGCAGG - Exonic
915563908 1:156703484-156703506 GAGCCAGGGATGCACTAGGCGGG + Intronic
919915790 1:202138266-202138288 GGGCAACGGAGGCCCCTGGGAGG - Intronic
920215880 1:204361369-204361391 GGGCCTGGGAGGAACCTGGCTGG + Intronic
920418226 1:205812837-205812859 GGGCCACGCTGCCACTTGCCAGG - Exonic
923086283 1:230705797-230705819 GGGCCGCGGTGGCACGGGGCTGG - Intronic
1066249139 10:33616090-33616112 GGGCCACAGGGGCAGTTGGTGGG - Intergenic
1067090909 10:43265535-43265557 GGGACATGGAGGACCTTGGCTGG - Intronic
1069638946 10:69942802-69942824 GCGCCACGGAGTCATGTGGCTGG - Intronic
1072732866 10:97859478-97859500 TGGCCAGTGAGGCACTTCGCCGG - Exonic
1075080176 10:119378367-119378389 GGGCCAAGAGGGGACTTGGCAGG + Intronic
1076385767 10:130053968-130053990 GACCCACGGTGGCACTTGGAGGG - Intergenic
1076819985 10:132933447-132933469 GGGCCACGGCCACGCTTGGCCGG + Intronic
1077478581 11:2802579-2802601 GGACCCAGGAGGCACTAGGCTGG - Intronic
1077479626 11:2807597-2807619 GGGTTGCGGAGGCACTGGGCGGG - Intronic
1083278455 11:61610954-61610976 GGGCCTCGGTGGGACTGGGCAGG - Intergenic
1083551035 11:63590412-63590434 GGGCCACGGAGGCTCAGAGCTGG + Intronic
1083935267 11:65866754-65866776 GGGGCAGGGTGGCACTTGGGGGG - Exonic
1084413199 11:69015603-69015625 AGGCCACAGAAGCACCTGGCAGG - Intergenic
1084455867 11:69267871-69267893 GGGCATTGGAGGCTCTTGGCTGG + Intergenic
1084477025 11:69394855-69394877 GGGCCACGCAGGGACAGGGCTGG + Intergenic
1084648354 11:70473806-70473828 TGGCCACTGAGGCATTTGGAAGG + Intronic
1085023793 11:73225004-73225026 GGGCAAGAGAGGCACTAGGCAGG - Intronic
1085100512 11:73796437-73796459 GGGCCAAGGAGGCAAGAGGCTGG - Intronic
1086329321 11:85737923-85737945 GGGTCACGGAGGCCCTGGGTGGG + Intronic
1086350695 11:85941206-85941228 GGGAGCCGAAGGCACTTGGCGGG - Intergenic
1086737176 11:90321095-90321117 GGGCCACAGAAACAATTGGCAGG - Intergenic
1089489625 11:118874111-118874133 GGGCAACTGAGACACATGGCAGG - Intergenic
1090091470 11:123702079-123702101 GCGCCACAGAGGCCCTTGGAAGG + Intergenic
1090344887 11:126062353-126062375 GGGGCTCGGAGGCACCTCGCGGG - Intronic
1096526085 12:52211194-52211216 GGGCCAAGGAGACACTCAGCCGG - Intergenic
1096608212 12:52782687-52782709 GGGCCACCAAGGCACTGGTCAGG + Intergenic
1097505636 12:60465885-60465907 GGGGCACGAAGGAACTTGGCAGG + Intergenic
1100367477 12:93935076-93935098 GGGCCACAGGAGCAGTTGGCAGG - Intergenic
1102585592 12:113920565-113920587 GGGCCACGGAGGCACTTGGCAGG - Intronic
1104800527 12:131552441-131552463 GGGCCACAGGAGCAGTTGGCAGG + Intergenic
1104912385 12:132245557-132245579 GGACCACGGAGGGCCCTGGCTGG - Intronic
1104912407 12:132245617-132245639 GGACCACGGAGGGCCCTGGCTGG - Intronic
1105069853 12:133227767-133227789 GGGACAGGGAGGCACCAGGCAGG + Intronic
1108686985 13:52828197-52828219 GGGCCAGGGAGTCCCTCGGCTGG - Intergenic
1113143621 13:107183073-107183095 TGGCGAGGGAGGCACGTGGCAGG - Intronic
1113325976 13:109281847-109281869 TGGCCACATAGGCACTTGCCTGG + Intergenic
1113567499 13:111327542-111327564 GGGCCACCGAGGGACTGGGCTGG - Intronic
1113631938 13:111893941-111893963 AGGCCAGGGAGGCAGTTGGGGGG + Intergenic
1115529252 14:34311740-34311762 GGGCCACAGAGGCACATACCTGG - Intronic
1118589356 14:67389930-67389952 GGGCCAGGGAGGGATGTGGCAGG - Intronic
1118819058 14:69333218-69333240 GGGCCTGGGAGGCTCTTGGGAGG + Intronic
1121271126 14:92638948-92638970 GGGCCATGGGGGCACCTGGGAGG + Intronic
1121545238 14:94758388-94758410 GCCCCAGGGAGGGACTTGGCTGG - Intergenic
1121614401 14:95303455-95303477 GGGCCGGGGAGGACCTTGGCGGG + Intronic
1122119022 14:99542007-99542029 GGGCCAGGCAGGCTCGTGGCAGG + Intronic
1122297211 14:100712303-100712325 GGGCCACAGAGGCAATGTGCCGG + Intergenic
1122696248 14:103554097-103554119 GGGCCTCGCAGGGACGTGGCTGG + Intergenic
1122959372 14:105087524-105087546 GGGCCAGGGAGGCTCCTGGCCGG - Intergenic
1123042393 14:105495747-105495769 GTCCCACAGAGGCACTGGGCAGG - Intronic
1123053861 14:105560169-105560191 GGGACAGGGAGGCACGTGGAGGG + Intergenic
1123078444 14:105680586-105680608 GGGACAGGGAGGCACGTGGAGGG + Intergenic
1123857254 15:24426588-24426610 AGACCACGGAGGGACTGGGCAGG + Intergenic
1123861883 15:24477116-24477138 AGACCACGGAGGGACTGGGCAGG + Intergenic
1123892301 15:24794023-24794045 AGACCACGGAGGGACTGGGCAGG + Intergenic
1124147354 15:27140003-27140025 GGGCCCCGGAGGCAGGTGCCAGG + Intronic
1124154642 15:27215218-27215240 GAGTCAGGGAGGCTCTTGGCAGG + Intronic
1125520251 15:40344407-40344429 GGGATCCAGAGGCACTTGGCAGG - Intergenic
1125535239 15:40438558-40438580 CGGCCAGGCAGGCACTTGGTGGG + Intergenic
1125718038 15:41830812-41830834 GGGCCAAGGAGGCAGGGGGCTGG - Intronic
1129168376 15:73792621-73792643 TGGCCAGGGAGGCAGTTGGTGGG + Intergenic
1130102792 15:80906577-80906599 CAGCCATGGAGGCACCTGGCAGG + Intronic
1134093852 16:11405921-11405943 TGGCCAAGGAGCCACTGGGCTGG - Intronic
1137675872 16:50303704-50303726 GGGTCTCGCAGGCACGTGGCAGG + Intronic
1138998179 16:62477960-62477982 GGGCCAAGGAGGCAGGGGGCTGG - Intergenic
1139563608 16:67759102-67759124 GGGCCCCAGAGGTACTTAGCTGG - Intronic
1140006092 16:71076480-71076502 GGGGCACTGAGGCACTGGCCTGG - Intronic
1141030308 16:80581780-80581802 GGGCCATGCAGGCTCATGGCCGG + Intergenic
1141095475 16:81159884-81159906 GGGTGACTGAGCCACTTGGCAGG + Intergenic
1141560269 16:84863145-84863167 GGCCTCCGGAGGCACATGGCAGG + Intronic
1141747313 16:85934286-85934308 GGGCCACAGAGGGATTTGGATGG + Intergenic
1142503678 17:349131-349153 GGGAAAAGGAGGGACTTGGCAGG + Intronic
1143166712 17:4900549-4900571 GGGCTAGGGAGGCACTGAGCCGG + Exonic
1143579872 17:7819161-7819183 GGGCCACTGAGGGACGTGGCAGG - Intronic
1144695410 17:17301083-17301105 GGGCCAAGGAGGCAGGGGGCTGG - Intergenic
1146503062 17:33380972-33380994 GGGCCAAAGAGGCCCTTGGAGGG + Intronic
1148260771 17:46181353-46181375 GGGGCACTGAGGCACTAGTCAGG - Intronic
1151196102 17:72432139-72432161 GGGCCTCGGATGAACTTGCCTGG - Intergenic
1151714659 17:75825226-75825248 GGGCCAGGGAGGCTCTTGTGGGG - Exonic
1152009188 17:77700520-77700542 GGGCCGGGCAGGCACTGGGCTGG + Intergenic
1152964128 18:98705-98727 GATCAAGGGAGGCACTTGGCAGG - Intergenic
1155500151 18:26479583-26479605 GGGCCGCGGAGGCACAGGCCTGG + Intronic
1155574243 18:27227702-27227724 GGGCCACAGGGGCCTTTGGCAGG + Intergenic
1157134871 18:45044440-45044462 GGGCCACCAAGGGACTCGGCAGG + Intronic
1160204469 18:76822180-76822202 GGGCCACGGAGGCGCGGGGCTGG + Exonic
1166113953 19:40641398-40641420 GGGGAAGGGAGGCGCTTGGCAGG + Intergenic
1166509574 19:43395792-43395814 GAGCCACGGAGGCTCCTGCCTGG - Intergenic
1166894895 19:46016927-46016949 GGGCCTGGGAAGCACTGGGCGGG + Intronic
1168063718 19:53908138-53908160 CGGCGACGGAGGCACACGGCAGG + Intergenic
1168345835 19:55649846-55649868 GGGCCAAGGAAGCAGATGGCAGG - Intronic
924965564 2:73421-73443 GTGCCCCGGAGGTCCTTGGCAGG + Intergenic
925005447 2:439863-439885 GAGCCACGGAGGCACAGAGCTGG + Intergenic
926442396 2:12903631-12903653 GGGCCACGGAGTCATTTTGGGGG + Intergenic
927147858 2:20178778-20178800 GGGTCAAGGAGGCAGTTGGTGGG - Intergenic
927648629 2:24897455-24897477 GGGACACACAGGCCCTTGGCAGG - Intronic
930146882 2:48016652-48016674 GGGCCATGGTGGCAGTTTGCGGG - Intergenic
930999612 2:57764580-57764602 GGGCAATGGAGGCACAGGGCTGG + Intergenic
934525351 2:95048410-95048432 GGGGCAGGCAGGCACCTGGCGGG - Intronic
935582493 2:104769115-104769137 GGACCTAGGAGACACTTGGCAGG - Intergenic
936083198 2:109449198-109449220 GTGACACGGTGGCAGTTGGCCGG - Exonic
936086374 2:109472299-109472321 GGGCCCGGGAGGCCCCTGGCCGG - Intronic
937958707 2:127438425-127438447 GGGCCATGGAGCCAGGTGGCGGG + Intronic
939015901 2:136903602-136903624 GGGTGACAGAGGCACATGGCAGG + Intronic
943669974 2:190649460-190649482 GGGCCACGCGGGCACTTTGGGGG + Intronic
948048969 2:234964989-234965011 GGGTCACGGGAGCACTGGGCTGG - Intronic
948159088 2:235809459-235809481 TGGCCACGGGGGCACTTTGCTGG - Intronic
948649330 2:239430223-239430245 GGACCGCGGTGGCTCTTGGCTGG + Intergenic
1168797836 20:623254-623276 GGGCCTCTGGGGCACTGGGCAGG - Intergenic
1171532338 20:25860901-25860923 GGGACCCAGAGGGACTTGGCTGG - Intronic
1172973500 20:38890013-38890035 TGGCGACAGAGGCAGTTGGCGGG + Intronic
1174365528 20:50054114-50054136 GGGCCAGGGAGGCAGTGGGATGG + Intergenic
1175259815 20:57667379-57667401 AGCCCACGGGGGCACTAGGCGGG + Intronic
1175821689 20:61913490-61913512 GGCCCACGGAGCCCCTTGGCAGG + Intronic
1176070943 20:63226234-63226256 GGGCCTCTGATGCACTTGTCCGG + Intergenic
1176377163 21:6092417-6092439 GGGCCATGTGGGCTCTTGGCCGG + Intergenic
1178927407 21:36787383-36787405 ACCCCATGGAGGCACTTGGCTGG + Intronic
1179746312 21:43445827-43445849 GGGCCATGTGGGCTCTTGGCCGG - Intergenic
1180190355 21:46159948-46159970 TGGCCACGCCGGCACTGGGCTGG - Intergenic
1180945127 22:19688505-19688527 GGGCCACGGGAGCACGTGTCCGG - Intergenic
1180980270 22:19875165-19875187 GTGCCAGGGAGGCTCTTGGGAGG - Intergenic
1181585361 22:23849923-23849945 GGGACACGGAGGCACCCCGCTGG + Intergenic
1182078591 22:27512537-27512559 GGGCCTCTGAGGCACTGGGAAGG - Intergenic
1184738498 22:46412907-46412929 GGGGCATGGTGGCACTTGCCTGG - Intronic
1185294984 22:50048819-50048841 GAGCCCCGGAGGGACTAGGCTGG + Intronic
950303056 3:11898651-11898673 GGGCCACAGACGCACTTCTCTGG + Intergenic
954681833 3:52350132-52350154 GGGCCAGGGAGGCACAGGGCTGG + Intronic
960988083 3:123293218-123293240 GGGCCAGGCAGGCGCTAGGCGGG + Intronic
968035410 3:195543892-195543914 GGGCCCAGGAGGTCCTTGGCTGG - Intergenic
968534193 4:1113246-1113268 GGGCCATGGGGGCACGTGGGGGG - Intronic
968929740 4:3572544-3572566 GGGCCTGGGAGGCCCCTGGCAGG - Intergenic
969264146 4:6054248-6054270 TGGCCACGGAGGCAAGGGGCAGG + Intronic
969313494 4:6367885-6367907 GGGCAACTTAGGCATTTGGCAGG - Intronic
969333823 4:6495112-6495134 AGGCCACGTAGCCCCTTGGCAGG - Intronic
969585623 4:8089894-8089916 AGGCCAGGCAGGGACTTGGCAGG - Intronic
969592064 4:8127664-8127686 GGGCCACAGAGGCTCTTCCCCGG - Intronic
969993429 4:11287809-11287831 TGGCCACGTGGGCACTTGGATGG - Intergenic
982994023 4:162317731-162317753 GGGCCAAGGAGGGAGTTGGTAGG - Intergenic
985889450 5:2704449-2704471 GCTCCACGGAGCCACATGGCAGG + Intergenic
987128576 5:14838856-14838878 GGGGCTGGGAGGGACTTGGCTGG - Intronic
987181529 5:15372940-15372962 TGGCCACAGAGGCTCTCGGCTGG + Intergenic
988510318 5:31859055-31859077 GGGCCACAGGACCACTTGGCAGG - Intronic
990473832 5:56142671-56142693 TGGCCACAGAGGAACCTGGCTGG - Intronic
990915943 5:60905979-60906001 GGGCCACAGGGGCAGTTGGCAGG + Intronic
994450003 5:99929662-99929684 GGGCCAAGGAGGCAGGAGGCTGG + Intergenic
997595254 5:135103103-135103125 GTCCCAGGGAGGGACTTGGCAGG + Intronic
999249927 5:150176493-150176515 GGGTCTCTGAGGGACTTGGCTGG + Intronic
1001633896 5:173196293-173196315 GAGCCAGGGAGGCGCTGGGCAGG + Intergenic
1002067426 5:176658949-176658971 GGGCCAAGGAGCCACATTGCTGG - Exonic
1002102078 5:176862628-176862650 TGGCCACGGTGGCACTCTGCTGG - Exonic
1002425541 5:179172448-179172470 GGGCCAAGGAGGCCCTGGCCAGG + Intronic
1002888272 6:1313776-1313798 GGGCCTCGGAGTGGCTTGGCGGG - Exonic
1002932045 6:1641479-1641501 GGGTCAGGCAGGCACTTGCCAGG - Intronic
1004720889 6:18266340-18266362 GGGCCAAGGCGGCAGGTGGCTGG + Intergenic
1006435925 6:34026296-34026318 GGGCCATGGAGGCACCGGGCAGG - Intronic
1007323497 6:41043401-41043423 GGGCCAGGGAGGGAGTTGGTGGG - Intronic
1007614369 6:43171676-43171698 GGGCCGCGGCGGCTCTGGGCCGG + Exonic
1007730277 6:43941300-43941322 GGCCCAGAGAGGCCCTTGGCTGG - Intergenic
1007759822 6:44127382-44127404 GGGCGAAGGCGGCGCTTGGCTGG - Exonic
1007775210 6:44221236-44221258 AGGCCAGTGAGGCACTTGCCAGG - Intronic
1007842341 6:44727222-44727244 GGGAAACGGAGGCCCTGGGCAGG - Intergenic
1016041542 6:139436817-139436839 AGGCCACAGAGGTATTTGGCTGG + Intergenic
1019051939 6:169190280-169190302 GGGCCCGGGAGACACTGGGCAGG - Intergenic
1019188255 6:170233878-170233900 AGTCCACAGCGGCACTTGGCAGG - Intergenic
1019406886 7:888667-888689 GGGCCACGGAGGCACCAGCCTGG - Intronic
1019739341 7:2665001-2665023 GGGCCTCGGAGTGACTGGGCGGG + Intergenic
1020235090 7:6348980-6349002 GGGCCGCGCAGGCGCGTGGCTGG - Intronic
1020474915 7:8583006-8583028 GGGCCAAGGGGGCAGGTGGCTGG + Intronic
1024980941 7:55157073-55157095 GGGCCACCAAGGCAGCTGGCTGG - Intronic
1027558128 7:79692125-79692147 GGACCACTGAGGCATTTGCCTGG + Intergenic
1032026476 7:128446469-128446491 GAGCCACGGAGTGAGTTGGCTGG + Intergenic
1033447508 7:141436014-141436036 CGGCCAGGGAGGAAGTTGGCCGG - Intronic
1033545337 7:142394389-142394411 AGCCCACGGAGGCACTGGGAGGG + Intergenic
1034897285 7:154885792-154885814 GGGCCACGCAGGCAGGGGGCGGG - Intronic
1038339114 8:26669328-26669350 GGGCCACAGGAGCAGTTGGCAGG + Intergenic
1038584554 8:28777298-28777320 GGGCCACGGAACCACTGTGCTGG - Intronic
1042485349 8:69340737-69340759 GGAACACGGAGCCACTTGACAGG + Intergenic
1043147294 8:76674198-76674220 GGGCGACGCAGGGACTTTGCTGG + Intergenic
1049206663 8:141366754-141366776 GGACCCCAGAGGCACTTGGCAGG - Intronic
1049425726 8:142537131-142537153 AGGGCCTGGAGGCACTTGGCGGG - Intronic
1050906484 9:11012308-11012330 GAGCCAAGGAGGCCATTGGCTGG - Intergenic
1053004326 9:34594084-34594106 GGGCCCTGGAGACACTGGGCTGG - Intergenic
1056291751 9:85150509-85150531 GGGCCCCCGAGGCACTAGGATGG - Intergenic
1060936513 9:127519331-127519353 GTGCCCGGGAGGCAATTGGCAGG + Intronic
1061936455 9:133860421-133860443 GGTTCACAGAGGCACTGGGCAGG - Intronic
1062464688 9:136675803-136675825 GAGCCCCGGAGGCGCTGGGCTGG - Intronic
1062641430 9:137520724-137520746 GACCCTGGGAGGCACTTGGCCGG - Intronic
1062657982 9:137613999-137614021 GGGCCAGGGAGGGGCTTAGCAGG - Intronic
1062733984 9:138125080-138125102 GATCAAGGGAGGCACTTGGCAGG + Intergenic
1187302752 X:18066975-18066997 GAGCCACTGAGGCACTTGGTAGG + Intergenic
1188686366 X:33075195-33075217 GGGCCACAGGAGCAGTTGGCAGG - Intronic
1190319558 X:49172169-49172191 GGGTGAGGCAGGCACTTGGCCGG + Intronic
1195086560 X:101418732-101418754 GGGGCACGCAGCCACCTGGCCGG + Intronic
1198082000 X:133248963-133248985 GGGCCACAGGAGCAGTTGGCAGG - Intergenic
1200047345 X:153409922-153409944 GGGCCATGGAGGCAGGGGGCGGG - Intergenic