ID: 1102588983

View in Genome Browser
Species Human (GRCh38)
Location 12:113943095-113943117
Sequence ACACTTAAGCAGAAACTGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 447
Summary {0: 1, 1: 0, 2: 3, 3: 49, 4: 394}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102588983_1102588984 5 Left 1102588983 12:113943095-113943117 CCATTCAGTTTCTGCTTAAGTGT 0: 1
1: 0
2: 3
3: 49
4: 394
Right 1102588984 12:113943123-113943145 TGCTGACCAGCCCACCCTTGCGG 0: 1
1: 0
2: 1
3: 12
4: 139
1102588983_1102588990 27 Left 1102588983 12:113943095-113943117 CCATTCAGTTTCTGCTTAAGTGT 0: 1
1: 0
2: 3
3: 49
4: 394
Right 1102588990 12:113943145-113943167 GTGACACCCTATCCCTCCCTTGG 0: 1
1: 0
2: 1
3: 10
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102588983 Original CRISPR ACACTTAAGCAGAAACTGAA TGG (reversed) Intronic
902452763 1:16508324-16508346 AGACTGAAGCAGAACATGAAAGG - Intergenic
902469940 1:16642314-16642336 ACATTTTAGCAGAAACTTAGAGG - Intergenic
903287210 1:22284802-22284824 ACAGTTAAGCAGAGACCTAAAGG + Intergenic
903501829 1:23804694-23804716 ACAGTTTAACAGAAACTAAAAGG - Intronic
905935064 1:41816890-41816912 ACACTTGAGCTGAATCTGGAAGG - Intronic
906007590 1:42490028-42490050 ACATTTAAGCAGAAACTCCTAGG + Intronic
906733199 1:48100849-48100871 AGAGGTAAGCAGAGACTGAAGGG + Intergenic
906922035 1:50075066-50075088 ACATTTAAGCAGAGACATAATGG + Intronic
907379783 1:54076981-54077003 ACATTTGAGCAGAAACTTGAAGG + Intronic
907818174 1:57940469-57940491 ACAGTTAAACAGCAAGTGAAGGG + Intronic
908593942 1:65665398-65665420 ACACATAGGCTGAAAATGAAGGG - Intergenic
908792617 1:67798054-67798076 AGACTGAGGCAGAAAGTGAAAGG - Intronic
909154118 1:72049063-72049085 ACATTTAAACAGAAACTAGAAGG + Intronic
909624754 1:77703272-77703294 ACATTTAAGCAAAGACTTAAAGG - Intronic
911061955 1:93756647-93756669 AAACCTTAACAGAAACTGAAAGG + Intronic
911824088 1:102459119-102459141 ACACATAGGCTGAAACTGAAGGG - Intergenic
912264365 1:108141066-108141088 ACACATAAGCTGAAAGTGAAAGG + Intronic
912391150 1:109303977-109303999 ACATTTGAGCAGCAACTTAAAGG - Intronic
912486619 1:110034419-110034441 ACATCTAAACTGAAACTGAAAGG + Intronic
912870524 1:113300485-113300507 AAACTTAACCAGATACTAAATGG - Intergenic
914002997 1:143708494-143708516 AGACTGAAGCAGACAATGAAAGG - Intergenic
914004819 1:143723231-143723253 AGACTGAAGCAGAACATGAAAGG - Intergenic
914094204 1:144530969-144530991 AGACTAAAGCAGACAATGAAAGG - Intergenic
914304323 1:146402919-146402941 AGACTAAAGCAGACAATGAAAGG + Intergenic
914597733 1:149169891-149169913 AGACTAAAGCAGACAATGAAAGG - Intergenic
915055727 1:153127736-153127758 ACACTTAACGAGACACTTAATGG + Intergenic
915589666 1:156863317-156863339 ACACTGAAAGAGAAACTGACAGG - Intronic
916392968 1:164352439-164352461 ACACACAAGCTGAAAGTGAAGGG + Intergenic
916530360 1:165650871-165650893 ATATTTAAGCAGAAATTGAATGG + Intronic
916547177 1:165816889-165816911 ACACTTAACCATTAACTGATTGG - Intronic
917813910 1:178688201-178688223 AAGCTAAAGCAGAAACAGAAGGG - Intergenic
918025053 1:180735427-180735449 ACACTTAATTAAAAACTTAAAGG - Intronic
918880438 1:190112649-190112671 ACAGTTAAGAAGACACTAAAGGG - Intronic
918940160 1:190984039-190984061 ACATTAAACCAGAATCTGAATGG + Intergenic
919445277 1:197697039-197697061 ACACAAAAGAAGAAACAGAATGG + Intronic
920036135 1:203067062-203067084 ACATTTAAGCAAAGACTTAATGG + Intronic
920426903 1:205885759-205885781 CCACTTAAACAGAGACTTAAGGG + Intergenic
921027148 1:211295703-211295725 GCACTTAAACAGAAAATGGAAGG + Exonic
921205551 1:212845592-212845614 CCACTTAAACAGAGACTTAAGGG - Intronic
921218958 1:212959884-212959906 CCACTTAAGGAGAAGCAGAAAGG - Intronic
921830970 1:219727172-219727194 ACAAATAGGCAGAAAGTGAAGGG + Intronic
921892366 1:220366252-220366274 ACATTTAAGCAGAGGCTTAAAGG + Intergenic
924575129 1:245273727-245273749 ACACATAGGCTGAAAATGAAAGG - Intronic
1063582271 10:7318868-7318890 ACATTTTAGCAGAGACTTAAAGG + Intronic
1065770869 10:29077064-29077086 ACACTTAAGCCGAGACCTAAAGG - Intergenic
1066571562 10:36778675-36778697 ACACTTAAAAAGAGCCTGAAAGG + Intergenic
1068187310 10:53602259-53602281 ACACATAGGCTGAAAGTGAAGGG - Intergenic
1068328138 10:55522681-55522703 ACACATAGGCTGAAAGTGAAGGG - Intronic
1068869379 10:61927154-61927176 TCTCTTGAGCAGAAAATGAAGGG - Intronic
1069221279 10:65886658-65886680 ACACATAAACTGAAAGTGAAAGG - Intergenic
1069760166 10:70804772-70804794 AGACCTAAACAGAAAATGAACGG - Intergenic
1070040581 10:72774672-72774694 ACACATAAGCTGAAAGTGAAGGG + Intronic
1070360764 10:75686338-75686360 ACACTTAAGCTGAGACCTAAGGG - Intronic
1071813754 10:89210045-89210067 ACACCAAAGCAGAAAATGAATGG - Intergenic
1072288918 10:93944090-93944112 ACATTTGAGCAGAGACTGCAAGG - Intronic
1074260640 10:111849938-111849960 AGACTTAAAAGGAAACTGAATGG - Intergenic
1074651971 10:115534473-115534495 ACACATAAGCTCAAAATGAAAGG - Intronic
1076299855 10:129417127-129417149 ACATTTAAGCAGAAAATAAAGGG - Intergenic
1076365379 10:129918334-129918356 TCACTGAAGAAGAAACTGAGGGG + Intronic
1078179566 11:8999793-8999815 ACATTTGAGGAGATACTGAAGGG - Intronic
1078393819 11:10960402-10960424 ACACATATGCTGAAAGTGAAGGG + Intergenic
1078970151 11:16400343-16400365 ACATTTAAGCAAAAACTTGAAGG + Intronic
1079046539 11:17109097-17109119 GCATTTAAGCATAAATTGAATGG + Intronic
1081624505 11:44641500-44641522 ATACTTAAACACAAACTGGATGG - Intergenic
1081895505 11:46582306-46582328 ATACTTAAGCAGAGACTAGAAGG - Intronic
1082872442 11:57955791-57955813 ACATTTAAGCAGAAAATGAAAGG - Intergenic
1083514722 11:63246299-63246321 ACTCCCAAGCAGAAACTGTATGG - Intronic
1085803592 11:79613881-79613903 ACATTTGAGCAGAAACCTAAAGG - Intergenic
1085888901 11:80554286-80554308 ACACTTCAGCAGAGACCTAATGG + Intergenic
1085933477 11:81114577-81114599 ACATTTAAGCAAAAACCTAAAGG - Intergenic
1085957643 11:81419461-81419483 ACACTAGAGCAGCAACTGAAAGG - Intergenic
1086699247 11:89881369-89881391 ACACCTAAGCTGAAACCCAAAGG + Intergenic
1086706925 11:89963141-89963163 ACACCTAAGCTGAAACCCAAAGG - Intergenic
1088397075 11:109380813-109380835 GCAGTTATGCAGAAAATGAAAGG + Intergenic
1088694449 11:112354979-112355001 AAACTCAAGCAGACACTGAAAGG - Intergenic
1089180095 11:116577614-116577636 GCACTTGGGCTGAAACTGAAAGG + Intergenic
1089367576 11:117930716-117930738 ATATTTGAGCAAAAACTGAAAGG + Intergenic
1090423910 11:126594025-126594047 CCAATAAAGCAGAAAGTGAAAGG - Intronic
1091593360 12:1858529-1858551 ACAGTTAAGCAGAAAATAATGGG - Intronic
1091760320 12:3083081-3083103 AAACTGCAGCAGAAACTGAAAGG - Intronic
1092510058 12:9145036-9145058 ACACATAGGCTGAAAGTGAAGGG - Intergenic
1093659756 12:21741976-21741998 ACACATAGGCTGAAACTGAAAGG - Intronic
1093695555 12:22156465-22156487 AGACTTAAGCAGAAACTTCAAGG + Intronic
1093803584 12:23404216-23404238 ATACATAAGCTGAAAGTGAAGGG + Intergenic
1093845557 12:23966310-23966332 GTATTTAGGCAGAAACTGAAAGG + Intergenic
1093890974 12:24520767-24520789 ACACATCAGCTGAAAGTGAAAGG + Intergenic
1093949387 12:25147325-25147347 ACACCTTAGGAGAAACTGAATGG - Intronic
1094326284 12:29243013-29243035 ACATTTTAGCAGAGACTCAAAGG + Intronic
1094455284 12:30625426-30625448 ACACGTAGGCTGAAAGTGAAGGG + Intergenic
1094734044 12:33212915-33212937 ACACATAAACAGAAAGTAAAAGG + Intergenic
1095155783 12:38852001-38852023 ACATTTAAGCAGAGGCTTAAAGG - Intronic
1095253263 12:40003403-40003425 ACACTTAACCAAAAAGTGAGTGG + Intronic
1095576101 12:43741184-43741206 ACATTTAAGCAAAAGCTGGATGG - Intronic
1095780237 12:46050766-46050788 ACACTAAAGAAAAAACTTAAAGG + Intergenic
1097379226 12:58875241-58875263 ACACTTAAGGAAAACCTAAAGGG - Intronic
1097764304 12:63506843-63506865 ACACATAGGCTGAAAGTGAATGG + Intergenic
1098236569 12:68423747-68423769 ACATTCAAGCAGACACTTAAAGG + Intergenic
1098295378 12:68998881-68998903 ACAGTTAATCAGGAACTGATTGG - Intergenic
1098413938 12:70212285-70212307 ACACATAGGCTGAAAGTGAAGGG - Intergenic
1099167006 12:79319267-79319289 TGACTTAAGCAGATACTCAATGG - Intronic
1100531532 12:95466192-95466214 GCACTGAAGCTGAAACTTAAAGG + Intergenic
1101141141 12:101797317-101797339 AGACACAAGCAGAAACAGAAGGG + Intronic
1101275242 12:103192523-103192545 ACACATAGGCTGAAAGTGAAGGG + Intergenic
1102474544 12:113180123-113180145 GCAATAAAGCACAAACTGAAAGG + Intronic
1102577896 12:113868310-113868332 ACAGTTTAGAAGCAACTGAAGGG + Intronic
1102588983 12:113943095-113943117 ACACTTAAGCAGAAACTGAATGG - Intronic
1102969399 12:117154350-117154372 TCAGTTAATCAGAAACTGAAAGG - Intronic
1103049071 12:117763610-117763632 ACACTCAAGGAGAGGCTGAAGGG + Intronic
1105320753 13:19319278-19319300 AAACTAAAGCAGGAAATGAAAGG + Intergenic
1106086671 13:26548839-26548861 ACATTTAAGTAGAACCTCAAAGG - Intergenic
1107503557 13:41006583-41006605 AGTCTTAAGAATAAACTGAAAGG - Intronic
1108305593 13:49128883-49128905 AAGCTTAAGCAGAAACTTGAAGG - Intronic
1108335316 13:49435349-49435371 ATACATAAGCATAAACTGCATGG - Intronic
1108764586 13:53611466-53611488 GGACTTAAGCAGAAACTGAAAGG + Intergenic
1108850749 13:54726228-54726250 ACACATAAGCTGTAAGTGAAGGG + Intergenic
1109766795 13:66910901-66910923 ACACATAGACAGAAACTCAATGG - Intronic
1109959307 13:69610260-69610282 AGACTGAGGCAGAAACTGGAGGG + Intergenic
1110747670 13:79073947-79073969 ACACATAGGCTGAAAGTGAAGGG + Intergenic
1110942249 13:81364800-81364822 ACACATAAGCTCAAAATGAATGG + Intergenic
1112207543 13:97339536-97339558 GCACTTCTGCAGAAACTGTAGGG + Intronic
1112557731 13:100484234-100484256 ATCCTTAAGCTGAAACTGTAAGG + Intronic
1112699342 13:101987406-101987428 ACATTTGAGCAGAGACTTAAAGG - Intronic
1113603630 13:111589076-111589098 ACATTAAATCAGAAACTGATTGG + Intronic
1114422076 14:22592698-22592720 CCACTTCATCAGAAACTGAAAGG - Intergenic
1115718824 14:36137135-36137157 ACATTTGAGCAGAAACACAAAGG + Intergenic
1118435294 14:65765599-65765621 ACACTTAAGCAGAAAGGGAGTGG - Intergenic
1118748554 14:68790942-68790964 TCAATTAAGCAGAGACTGATTGG - Intronic
1118965043 14:70573662-70573684 GCATTTAAGCTGAAAGTGAAGGG + Intergenic
1120149877 14:81021274-81021296 ACACTTAAGCAGAGCCTCAGTGG - Intronic
1120508872 14:85388152-85388174 ACAGTGAAGCAAAAACAGAATGG - Intergenic
1123793784 15:23751083-23751105 AAACCTAAGAAGGAACTGAAAGG + Intergenic
1125118411 15:36122851-36122873 GCATTTAAGCAGAGGCTGAAGGG + Intergenic
1125677328 15:41509488-41509510 ATACTGAATCAGAAACTGTAAGG - Intronic
1125700933 15:41682963-41682985 ACACGTAAGAAGAAATTGAGGGG - Intronic
1125778011 15:42235682-42235704 ACATTTAAGCAGAGACTTCAAGG - Intronic
1126506900 15:49415436-49415458 AAAGTTAAGCAGTAACTTAAGGG + Intronic
1127847090 15:62879906-62879928 ACAATTATGCAGAAGGTGAAGGG + Intergenic
1128561747 15:68673146-68673168 GCCCTTCAGCAGTAACTGAAAGG + Intronic
1128719480 15:69936864-69936886 ACACATAAGCTGAAAGTGAAGGG + Intergenic
1128844646 15:70880312-70880334 ACAATTAACAAGAAAATGAATGG - Intronic
1128951180 15:71883890-71883912 AAACTTCACCTGAAACTGAAAGG + Intronic
1129172338 15:73815932-73815954 ATATTTAAGCTGAGACTGAACGG - Intergenic
1130035131 15:80352665-80352687 ACCTTTAAGTAGACACTGAAGGG + Intronic
1130629703 15:85554405-85554427 ACAGTAAGTCAGAAACTGAATGG - Intronic
1132083476 15:98886873-98886895 TCACTGAAGCACAACCTGAAAGG - Intronic
1132941706 16:2511776-2511798 GAACTTAGGCAGAAAATGAATGG + Intronic
1133052589 16:3125645-3125667 ACATTTAAGCTGAGACTCAAAGG + Intergenic
1135871909 16:26159002-26159024 ACACTGAGGCAGAAACAGACTGG - Intergenic
1136468938 16:30465479-30465501 ACATTCAAGCAGAGACTGAAAGG + Intergenic
1137703392 16:50515762-50515784 ACACATAGGCTGAAAGTGAAAGG - Intergenic
1138509732 16:57501501-57501523 ACCCTTAAGGTGAAAGTGAAAGG + Intergenic
1140047390 16:71450809-71450831 ACAACTAAGAAGAAACTGCAGGG - Intronic
1140072979 16:71668796-71668818 ACACTTAACCAGGAAGTGACGGG - Intronic
1140408383 16:74725997-74726019 ACACATCAGCAGAAACTAAATGG - Intronic
1141603485 16:85139959-85139981 GCATTTAAGCCGAAAATGAAAGG + Intergenic
1144293679 17:13853031-13853053 ACATTTGAGCAGAAACTTGAAGG + Intergenic
1147012482 17:37461764-37461786 TCACTTAAGATGAAACCGAAAGG - Intronic
1148726213 17:49792357-49792379 ACATTCAAACAGAAAGTGAAGGG - Intronic
1148853543 17:50566372-50566394 ACACGTAAGCATAAACGGACAGG - Intronic
1149727616 17:58912359-58912381 ACATTTAAGCAGAGACTTGAAGG + Intronic
1151069792 17:71195791-71195813 ACATTTAAGCTGAGAATGAAAGG + Intergenic
1151276951 17:73042054-73042076 ACACTTACACAGAAATGGAAAGG - Intronic
1153558373 18:6342858-6342880 ACACTTAGGCTGAAAGTAAAAGG + Intronic
1155140755 18:23042224-23042246 CCACTTAGGCACAAACTGAGAGG + Intergenic
1155720902 18:29010598-29010620 AAACTGAAGCAGAAAATAAAAGG + Intergenic
1156140802 18:34108472-34108494 ACACATAGGCTGAAAGTGAAAGG + Intronic
1156177445 18:34563449-34563471 ACAATTAAGCAAAAACTGGTTGG - Intronic
1156814031 18:41287136-41287158 AAAATTAAGCAGAAAGTGCAGGG - Intergenic
1157194599 18:45610557-45610579 ACACTGAAGCTGAAAGGGAAGGG + Intronic
1157738466 18:50071423-50071445 GCACTGAAGCAGATGCTGAATGG + Intronic
1158423550 18:57318316-57318338 ACACATAGGGAGAAAATGAAGGG - Intergenic
1158980009 18:62750864-62750886 ACAATTAAAGAGAAAATGAAAGG + Intronic
1159986729 18:74850659-74850681 GTATTTGAGCAGAAACTGAAAGG - Intronic
1160153911 18:76417768-76417790 AAACTTATGCAGAAACTCAATGG - Intronic
1161875416 19:6904863-6904885 ACATTTAAGCAGAAACCTGAAGG + Intronic
1162876424 19:13624098-13624120 CCACAAAAGCAGACACTGAACGG + Intergenic
1164036248 19:21458352-21458374 CAACTAAAGCAGAAATTGAAAGG - Intronic
1167457389 19:49604117-49604139 ACACTTAAGAAGAAAGTGTAAGG - Intronic
925570561 2:5307383-5307405 AAACATAAGAAGAATCTGAAAGG - Intergenic
925672958 2:6331374-6331396 ACACTTAAGCTCAAAATAAAGGG - Intergenic
925832720 2:7911824-7911846 ACAGCTAGGCAGAAACTCAAAGG + Intergenic
926014879 2:9442137-9442159 AGAATTATGCAGACACTGAATGG + Intronic
926677397 2:15637685-15637707 ACACTGGAGCACAAACTGCACGG - Intergenic
928571538 2:32614297-32614319 GCACTAAAGAAGGAACTGAAAGG - Intronic
929728959 2:44465813-44465835 AGACTTAGGCTGAAAGTGAAAGG + Intronic
930613434 2:53568540-53568562 ACACTTGAGCAGTAATTCAAGGG - Intronic
931523885 2:63131055-63131077 ACACATAAGCTGAAATGGAAAGG - Intronic
932193701 2:69764090-69764112 ACCCATAAGAAGAGACTGAAGGG + Intronic
933988875 2:87618443-87618465 ACACATAGACAGAAACTGAAGGG + Intergenic
934777184 2:96946953-96946975 GCACAAAAGCAGAAACTTAAAGG + Intronic
935139571 2:100340675-100340697 ACATTTATGCCGAAGCTGAATGG - Intergenic
935802997 2:106717297-106717319 AAAGTTTACCAGAAACTGAAAGG + Intergenic
936105687 2:109622691-109622713 GCACTTAAGCATTAACGGAAGGG + Intergenic
936304969 2:111332384-111332406 ACACATAGACAGAAACTGAAGGG - Intergenic
936696835 2:114960682-114960704 TCACTGGAGCAGAAACTGTATGG - Intronic
936968994 2:118156731-118156753 ACACTAAAGTAAAAACTGAAAGG + Intergenic
937141607 2:119606480-119606502 AGACTTAAGCTGAGACAGAAGGG - Intronic
939145468 2:138409443-138409465 ACACTTAGGCTAAAAGTGAAGGG - Intergenic
939444424 2:142290425-142290447 ACTCCAAAGCAGAAAATGAAAGG + Intergenic
940111992 2:150165152-150165174 CCACTAAAGCTGTAACTGAAAGG - Intergenic
942653078 2:178188951-178188973 ACACTTAAGCAAAGACTTGAAGG - Intergenic
942694055 2:178618747-178618769 ACCCCAAAGCAGAAGCTGAATGG - Exonic
942734136 2:179091272-179091294 ACACATAAGCTCAAAATGAAGGG - Intergenic
944269186 2:197761728-197761750 ACACATAGGCTGAAAGTGAAGGG + Intronic
944900885 2:204214565-204214587 AAAAGTAAGCAGAAACTGCAGGG - Intergenic
945389721 2:209249362-209249384 ACACATAAACTGAAAGTGAAGGG + Intergenic
945754226 2:213827052-213827074 ACACATAAGAAGAAAATAAAGGG - Intronic
946662544 2:222016561-222016583 AGACTTGAGCAAAGACTGAAAGG - Intergenic
948235902 2:236390332-236390354 ACACATAGGCTGAAAGTGAAGGG - Intronic
948564226 2:238873407-238873429 ACGCTTGAGCAGAGAATGAATGG + Intronic
1169717150 20:8632626-8632648 ACACTTAAGCAAAGACTGGAAGG + Intronic
1170087103 20:12545806-12545828 ACACATAAACTGAAAGTGAAGGG - Intergenic
1170396048 20:15926644-15926666 ACATTTAAGCAGTAACTTGAAGG + Intronic
1171153899 20:22853664-22853686 ACACTTAAGCTCAAAATAAAGGG + Intergenic
1171544247 20:25988557-25988579 CCAATTAAGCAGAAACAGATTGG - Intergenic
1172175909 20:32971703-32971725 AGACTGAAGCAGAAAGAGAATGG - Intergenic
1172658863 20:36553333-36553355 TCACTTAAGGAAACACTGAAAGG - Intergenic
1174057942 20:47811454-47811476 ACATTTAGGCAGAAAATGAAGGG - Intergenic
1175140036 20:56854153-56854175 ACATTTGAGCAGAAACTGGAAGG - Intergenic
1175206529 20:57316028-57316050 GCACTTGAGCAGAAACCTAATGG + Intergenic
1175327595 20:58140531-58140553 ACACATTAACACAAACTGAATGG + Intergenic
1175505091 20:59477061-59477083 AAGCTTAATCAGAAACTCAAAGG + Intergenic
1177017761 21:15813892-15813914 AAACTATATCAGAAACTGAAAGG - Intronic
1177566062 21:22821875-22821897 ACACATAGGCTGAAAGTGAAGGG + Intergenic
1177776594 21:25574574-25574596 ACTCTTAAAGGGAAACTGAAAGG + Intergenic
1180576748 22:16783236-16783258 GTACTTAAGGAGAATCTGAAAGG - Intergenic
1184642560 22:45880212-45880234 ACTCTTAAGCAGTCACTGCACGG - Intergenic
1184811498 22:46836755-46836777 ACACATAGGCTGAAAGTGAAGGG + Intronic
1185301431 22:50083234-50083256 ACAGTGAAGCAGAAGTTGAAGGG - Intronic
949133002 3:528582-528604 ACACATAAACTGAAAGTGAAAGG - Intergenic
951343530 3:21517976-21517998 ACATTGAACCAGAAACTGAGAGG + Intronic
952169053 3:30785240-30785262 ACATTCAAGTGGAAACTGAAAGG - Intronic
952467172 3:33601521-33601543 AATCTTAAGCAAAAACTAAAAGG - Intronic
952874381 3:37931039-37931061 ACACATAGGCTGAAAGTGAAAGG - Intronic
952879355 3:37973682-37973704 ACAATGAAGCAGATACTGAAAGG - Intronic
953008199 3:38997393-38997415 ACAGTTGAGCAGAGACTTAAAGG - Intergenic
953224673 3:41007464-41007486 ACACATAGGCTGAAAGTGAAGGG - Intergenic
953325336 3:42008005-42008027 ACACTTAAGCTGAGACCCAAAGG - Intergenic
953729337 3:45431942-45431964 ACAAATAAGCTGAAAGTGAAAGG + Intronic
954168836 3:48783194-48783216 ACATTCAAGCAGAAACCTAAAGG + Intronic
954299492 3:49691940-49691962 ACATTTTAGCAGAAACTTAGAGG + Intronic
954978808 3:54724040-54724062 ACACATAGGCTGAAAATGAAGGG + Intronic
955559909 3:60177743-60177765 ACTCTTTAGCTGAACCTGAAAGG - Intronic
956015241 3:64875439-64875461 ATAGTTAAGCTGAAACTCAAAGG + Intergenic
956717281 3:72089401-72089423 ACACTTAAGCAGCCTCTGCAGGG + Intergenic
957669844 3:83286870-83286892 ACTCTTATGAAGAAACTGATTGG - Intergenic
958699831 3:97574373-97574395 ACACTTAAGCAGAGTCTTGAAGG + Intronic
959043508 3:101445662-101445684 ACACATAAACTGAAAGTGAAGGG + Intronic
959294364 3:104516618-104516640 ACTCTTATGAAGAAACTGATGGG - Intergenic
959479642 3:106855466-106855488 ACACATAAGCTCAAAATGAAGGG + Intergenic
959609945 3:108282308-108282330 AGAGTTCAGCAGAAACTGACAGG + Intergenic
960296354 3:115949292-115949314 AAACTGAAGTAGAAACTAAATGG - Intronic
960469402 3:118042613-118042635 ACACGTAGGCAAAAAGTGAAGGG + Intergenic
960777351 3:121272487-121272509 ACACATAGGCTGAAAGTGAAGGG - Intronic
961312183 3:126010015-126010037 AAACGTAAGCAGATTCTGAAAGG + Intronic
961512999 3:127414530-127414552 ACACTTAAGCAGGAATGGACTGG - Intergenic
961570296 3:127792954-127792976 ACATCTGGGCAGAAACTGAAGGG + Intronic
962489184 3:135874992-135875014 ACACATAGGCTGAAAGTGAAGGG + Intergenic
962647482 3:137454747-137454769 ACACTAAAGCAGAAAGTTAAGGG - Intergenic
962831872 3:139149666-139149688 ACATTTAAGCAGAGACTTTAAGG + Intronic
963976882 3:151490165-151490187 ACACATAGGCTGAAAGTGAAGGG + Intergenic
964246989 3:154665614-154665636 ATACTTGAGCAGAAACTTGAAGG + Intergenic
964314894 3:155433470-155433492 ACCGTTAAGAAGAAACTCAAAGG + Intronic
965638338 3:170807442-170807464 ACAGTGAAGAAGACACTGAACGG - Intronic
966364119 3:179164330-179164352 TCACTTAAGCACTGACTGAAAGG - Intronic
966546400 3:181154072-181154094 ACACTTATGCAGAAGAAGAAAGG - Intergenic
967866569 3:194194808-194194830 ACATTGCAGCAGAAACTGAGGGG + Intergenic
967948200 3:194820672-194820694 AGACTCAAGCAGAAGCTGTAGGG - Intergenic
967954593 3:194868735-194868757 ACACTTAAGCTGAGCCTCAAAGG + Intergenic
967959823 3:194911554-194911576 ACACTTAAGCTGATACCTAAAGG + Intergenic
970125047 4:12799766-12799788 ACTCTAAAGGAGAAACTGGAAGG - Intergenic
970690709 4:18617222-18617244 ACACTTAAACTGAAACTCAAAGG - Intergenic
972728196 4:41764984-41765006 ACACATAAGCAAAAACTCTAAGG - Intergenic
973880671 4:55268625-55268647 AAACCCAAGCAGAAACTGCAAGG + Intergenic
974200831 4:58637972-58637994 ACACTTACGCAGAAAAGCAAAGG + Intergenic
974563776 4:63556309-63556331 ACTCTTAAGGAGAAAGGGAAAGG - Intergenic
974576217 4:63727183-63727205 ACACATAAACTGAAAGTGAAGGG - Intergenic
974870744 4:67637972-67637994 AAATTTAGGCTGAAACTGAAAGG + Intronic
975224344 4:71853595-71853617 ACACATAGGCAGAAAGTAAAGGG - Intergenic
975299688 4:72775146-72775168 ACTCTTAAGCAGAAAGGGACAGG + Intergenic
975923647 4:79423109-79423131 ACATTTGAGCAGAGACTGAAAGG + Intergenic
976333302 4:83856530-83856552 GCACTTAAACAAAAACTCAATGG - Intergenic
977441466 4:97073261-97073283 ACGCTCAGGCAGAAATTGAAGGG + Intergenic
979280732 4:118864811-118864833 ACACATAGGCTGAAAATGAAGGG - Intronic
979515563 4:121605853-121605875 ACACATAAGCAGAGAGTGGAGGG - Intergenic
979574525 4:122272384-122272406 ACTCTTAAGGAAAAAATGAAAGG + Exonic
980455833 4:133041601-133041623 ACACAAAAGCTGAAAGTGAAGGG + Intergenic
981124742 4:141092950-141092972 ACAGGTAAGCTAAAACTGAAGGG + Intronic
981140948 4:141268584-141268606 ACACATAAGCAGAATATGTATGG + Intergenic
982534309 4:156589632-156589654 ACTCGGAAGCAGAGACTGAATGG + Intergenic
983629525 4:169835792-169835814 AGACTTAAGAAGACATTGAAGGG - Intergenic
983665581 4:170177965-170177987 ACACATAGGCTGAAACTAAAGGG - Intergenic
983695363 4:170521993-170522015 ATACTGAAGTAGAAAATGAAGGG - Intergenic
983953683 4:173672786-173672808 ACATTTAAGCAGAGACTCAAAGG + Intergenic
984386238 4:179061951-179061973 AGACATAAGCAGAAAGTGAAGGG + Intergenic
984463496 4:180067260-180067282 AAACTTAACCAGAATCTGAAGGG + Intergenic
985305417 4:188533933-188533955 CCACTTAACCAGAAGCTTAAGGG - Intergenic
986504792 5:8438630-8438652 ACACGTGAGCAAAAACTTAAAGG + Intergenic
987167021 5:15209790-15209812 ACACTTGAGCTGAGACTGGAAGG - Intergenic
988396505 5:30702598-30702620 ACATTTAAGCAAAAACTTGAAGG + Intergenic
988643872 5:33072371-33072393 ACACTTAAACAAAACTTGAAAGG - Intergenic
989616168 5:43338937-43338959 ACACTTAAGCTGAGACTTGAAGG + Intergenic
989754232 5:44933428-44933450 ACACATAAACTGAAAGTGAAGGG - Intergenic
990229430 5:53695732-53695754 ACACGTAAGCTGAAAGTGAAAGG + Intergenic
991186451 5:63814528-63814550 ACAATCATGCAGAAAGTGAAGGG - Intergenic
992055059 5:72980812-72980834 ACACATAAGCACAAAATAAAGGG - Intronic
994094496 5:95836672-95836694 AAACTAAAGCTGAAACTGAAAGG + Intergenic
994110536 5:95998203-95998225 ATACATAAGCAGAAAATGTATGG - Intergenic
994629635 5:102268464-102268486 ACACTTAGACTGAAAGTGAAGGG - Intronic
994807165 5:104463676-104463698 ACACATAGGCAGAAAATAAAGGG - Intergenic
994865244 5:105260288-105260310 TCACATCAGCAGAAACTGACAGG + Intergenic
994910573 5:105900373-105900395 ACACAAAAATAGAAACTGAAAGG + Intergenic
995004346 5:107172671-107172693 ATACTTAAGCAGTATCTCAAAGG - Intergenic
995825057 5:116287440-116287462 ACACATAGGCTGAAAGTGAAAGG - Intronic
996080373 5:119252612-119252634 ACACTGTAGCAGAAAATGATTGG + Intergenic
996262621 5:121492119-121492141 ACACAGAAGCAGAAAGTGAAAGG - Intergenic
996652038 5:125889965-125889987 AAACTTAAGCAGAAAGTACACGG + Intergenic
996959569 5:129230680-129230702 GCAGGTAATCAGAAACTGAAAGG - Intergenic
997302595 5:132816779-132816801 CCACTCAAGCAGAAACAAAATGG - Exonic
997741656 5:136260196-136260218 ACAGTTAAACAGAAGATGAAAGG + Intronic
998751525 5:145327479-145327501 ACACATAGGCTGAAAGTGAAGGG - Intergenic
999072248 5:148757396-148757418 ACACATAAGCTGAAAGTGAAAGG - Intergenic
999309037 5:150539609-150539631 ACACATGAGCAAAGACTGAAGGG - Intronic
999527237 5:152420852-152420874 ACCCTTAAGCAGAAATCCAAAGG - Intronic
1000414169 5:160966033-160966055 AAATTTAAGCAGAAACTCAAAGG + Intergenic
1000842384 5:166236493-166236515 ACACATAGGTTGAAACTGAAAGG + Intergenic
1000934040 5:167286619-167286641 AAACTACAGCAGAAAATGAAAGG - Intronic
1001404170 5:171463868-171463890 ATATTTAAGCAGAAGCTGTAGGG - Intergenic
1001465763 5:171964472-171964494 AGTCTTCAGCAGAAACTGAATGG - Intronic
1002028435 5:176411454-176411476 GCATTTGAGCAGAAGCTGAAGGG - Intronic
1002156330 5:177283541-177283563 ACACTAAAGCAGAGACTGTGGGG - Intronic
1004027864 6:11836788-11836810 TCAGTTAAGAAGAAACTGATGGG - Intergenic
1005264896 6:24101371-24101393 ACAATTAAGAAGAAATTGCAAGG - Intergenic
1005433043 6:25778794-25778816 ACACTTAAGCAAGGACTGAAAGG + Intronic
1005616520 6:27578172-27578194 ACACTTAAGTAGCAAATGAGAGG - Intergenic
1006529212 6:34635926-34635948 AATCTTAAGAAGAAACTGGAAGG + Intronic
1009506626 6:64490227-64490249 ACACTAAAACTGAAAATGAATGG + Intronic
1010013036 6:71071798-71071820 ATACTTATATAGAAACTGAAGGG - Intergenic
1011010646 6:82699981-82700003 ATACATACTCAGAAACTGAAAGG - Intergenic
1011102681 6:83741587-83741609 ACACATAAGCTGAAAATAAAGGG - Intergenic
1012149618 6:95731810-95731832 AGACTCAAGAAGAAACTCAATGG + Intergenic
1012414165 6:98994362-98994384 ACACTTAAGCAGACACCTCAAGG - Intergenic
1015004855 6:128267075-128267097 ACAAATAAGCAGAAACAAAAAGG + Intronic
1015105235 6:129528684-129528706 AGACTGAAGCAGAAACACAATGG - Intergenic
1015421610 6:133016974-133016996 ACATCTAAGCTGAGACTGAAAGG + Intergenic
1016085948 6:139914684-139914706 AAAGTTAAGCATACACTGAACGG - Intergenic
1016192352 6:141286349-141286371 ACACATAGGCTGAAAGTGAAGGG - Intergenic
1016930410 6:149401342-149401364 ACACATAGGCAGAAAGTGAAGGG + Intronic
1018579121 6:165292502-165292524 ACAAAAAAGCAGAAACTTAAGGG - Intronic
1020553608 7:9640505-9640527 AATATCAAGCAGAAACTGAATGG - Intergenic
1020623964 7:10555551-10555573 ACACATAGGCTGAAAGTGAAAGG + Intergenic
1020625156 7:10568970-10568992 ACATTTCAGGAGAAACAGAATGG - Intergenic
1020843454 7:13252206-13252228 ACACATAAGCTAAAAGTGAAGGG - Intergenic
1021179184 7:17486569-17486591 ATAATTAAGCAGAAATAGAAAGG - Intergenic
1021304680 7:19017857-19017879 ACACTTAGGTAGAAAGTGAAAGG + Intergenic
1023072793 7:36454037-36454059 AGTCTTTAGCAGATACTGAATGG + Intergenic
1023188987 7:37559038-37559060 ACACTTTAGTAGAAAATGCAGGG + Intergenic
1023195671 7:37636071-37636093 AGACATAAGTAGACACTGAAAGG - Intergenic
1024677422 7:51649350-51649372 ATACTCAAGCAGAAACTGTGCGG - Intergenic
1025770166 7:64497509-64497531 CCACATAAGGAAAAACTGAAAGG + Intergenic
1026495748 7:70901185-70901207 ACACATAGGCTGAAAGTGAAAGG - Intergenic
1026497257 7:70913960-70913982 AGACATGAGCAGAAACTGGAAGG + Intergenic
1026876058 7:73879738-73879760 TCACTCAAGCAAAAGCTGAAAGG - Intergenic
1027527269 7:79286015-79286037 TCAATTAAGCAGAAACTATAAGG + Intronic
1027584036 7:80034494-80034516 AAAGTTAAGCAGTTACTGAAGGG - Intergenic
1027701996 7:81480707-81480729 ACACTTATGCTCAAAATGAAGGG + Intergenic
1028790390 7:94847362-94847384 AGAAGTAGGCAGAAACTGAAGGG - Intergenic
1029261359 7:99304882-99304904 ACTGTTAAGAAGAAATTGAAAGG + Intergenic
1030109591 7:106015490-106015512 AGAATTAAGCAGCAACCGAATGG - Intronic
1030165637 7:106552397-106552419 AAACATAAGCAAAAGCTGAATGG + Intergenic
1030354039 7:108523589-108523611 ACCTTAAAGCAGAAGCTGAAGGG - Intronic
1031588092 7:123557066-123557088 GCACCTAAGCAGAAACGGTAAGG + Intronic
1031982656 7:128137565-128137587 TCATTTGAGCAGAAACTGGAAGG - Intergenic
1033669189 7:143474011-143474033 ACACGTAAGATGAAACTGAAGGG + Intergenic
1035819786 8:2579028-2579050 ACTCATGAGCAGAAGCTGAATGG - Intergenic
1035975482 8:4305855-4305877 ACACGTAAGCAAAGACTGGAAGG - Intronic
1037385847 8:18340360-18340382 ACACATAAGCTGAAAATGAAGGG + Intergenic
1037656944 8:20892533-20892555 TCAATTTAGCAGAAACTGCAGGG - Intergenic
1037873164 8:22519244-22519266 ACACATAAGCTGAAAGTAAAAGG - Intronic
1038551805 8:28476306-28476328 AGACTCAAGTAGAAACTGATGGG + Intronic
1039150711 8:34502265-34502287 ACAATTATGCAGAAGGTGAAAGG + Intergenic
1039242671 8:35573674-35573696 ACTCTTAAACAGAATCAGAAAGG - Intronic
1040452323 8:47560486-47560508 ACTTATAAGCAGAAACTGGAAGG - Intronic
1040863745 8:52026984-52027006 ACACATAAGCTCAAAATGAAGGG - Intergenic
1042287232 8:67127078-67127100 AGAGCTAAGGAGAAACTGAAAGG + Intronic
1042986030 8:74583983-74584005 ATTCTTAAGCAAAAACTAAAAGG - Intergenic
1043005810 8:74816958-74816980 AAAATTAAGCTGAATCTGAAGGG - Intronic
1043553667 8:81404448-81404470 ACATTTAAGCAGAAACCAGAGGG + Intergenic
1043962774 8:86436366-86436388 ACATTTAAACAGAAACATAAAGG - Intronic
1044025449 8:87165616-87165638 ACACATAGGCTGAAAGTGAAGGG - Intronic
1044282986 8:90377700-90377722 ACACTTAGGCTCAAAATGAAGGG + Intergenic
1044542787 8:93426533-93426555 ACACTGCATCTGAAACTGAATGG + Intergenic
1044730004 8:95221934-95221956 ACATTTGAGCAGAGACTGAAGGG + Intergenic
1045780535 8:105857666-105857688 ACACATAGGCAGAAAGTGAAGGG + Intergenic
1046298053 8:112247778-112247800 ACACTGAATCAGAAACTGTTAGG + Intronic
1046655997 8:116895074-116895096 ACACATAAGCTGAAAGTGAAGGG + Intergenic
1046761983 8:118030880-118030902 ACACTGAAGAAGAAACAAAAAGG + Intronic
1047706130 8:127501584-127501606 AGAATTCAGAAGAAACTGAATGG - Intergenic
1048349391 8:133603855-133603877 ACACTCAAGCACAAACTCAAAGG - Intergenic
1048642757 8:136382771-136382793 ACACCTCAGAAGAGACTGAATGG - Intergenic
1049451926 8:142666603-142666625 ACACTCCAGCTGAAACTCAAGGG + Intronic
1049956267 9:695935-695957 ACACTTCAGCAGATACTAAGAGG + Intronic
1050769527 9:9179671-9179693 ACACTTAAGGAGGAACTGGCAGG + Intronic
1050859901 9:10414823-10414845 AAACTAATGCAGAAACAGAAAGG + Intronic
1052132067 9:24860059-24860081 ACACATAAGCTGAAAATAAAGGG + Intergenic
1052496125 9:29227083-29227105 ACAGTTAAGCAGAAAAACAAAGG - Intergenic
1052643550 9:31201485-31201507 ACACTTAATCTTATACTGAATGG + Intergenic
1053337620 9:37289939-37289961 ACATTTAAGCAACAACTTAAAGG - Intronic
1053492516 9:38520159-38520181 ACTCTTAGGCATACACTGAAAGG + Intergenic
1053618885 9:39796114-39796136 TCACTGAAGCAGTACCTGAAGGG - Intergenic
1053895618 9:42739232-42739254 TCACTGAAGCAGTACCTGAAGGG + Intergenic
1054265269 9:62911315-62911337 TCACTGAAGCAGTACCTGAAGGG + Intergenic
1055367020 9:75555534-75555556 ACATTTAAGCTGAATCTTAAAGG + Intergenic
1055558913 9:77503086-77503108 ACACATAAGAAGACTCTGAAGGG - Intronic
1055904920 9:81282070-81282092 ACACTTTAGTAGAAATAGAAAGG + Intergenic
1056742663 9:89272804-89272826 ACACATTAGCTCAAACTGAAAGG - Intergenic
1057877657 9:98770243-98770265 ACAATCATGCAGAAGCTGAAAGG - Intronic
1060501836 9:124163476-124163498 ACAAGCAGGCAGAAACTGAAGGG - Intergenic
1186103676 X:6182901-6182923 ACACATAATCACAAACTTAATGG - Intronic
1186501237 X:10052400-10052422 ACACTTAAGAAAGAACTGGAAGG - Intronic
1186796100 X:13047935-13047957 ACAGTTAATCAGAAACTTAGTGG - Intergenic
1186956710 X:14689933-14689955 ACACTTAAGCAAACACTGAAGGG + Intronic
1186985244 X:15006037-15006059 ACACATAGGCTGAAAGTGAAGGG + Intergenic
1187175754 X:16895009-16895031 ACATTTAAGCTGAGACTCAAAGG - Intergenic
1187618347 X:21022413-21022435 ACACATAAACAGAAAATAAAAGG + Intergenic
1188701550 X:33270602-33270624 ACACTTGAGAAGAAACTAGACGG + Intronic
1191055792 X:56238997-56239019 ACAGTCAAGAAGAAACAGAAAGG - Intronic
1191882827 X:65859679-65859701 ACATTTGAGCAGAACCTCAAAGG - Intergenic
1192111063 X:68365238-68365260 ACATTTGAGCAGAGACTTAAAGG + Intronic
1192395618 X:70778020-70778042 ACACATAGGCTGAAAGTGAAGGG + Intronic
1192479563 X:71473291-71473313 ACCTTTAAGCTGAATCTGAATGG + Intronic
1193355755 X:80519063-80519085 ACACATAAGCTCAAAATGAAGGG - Intergenic
1193862589 X:86688472-86688494 CCACTTAAGCACAGAGTGAATGG + Intronic
1194724002 X:97373575-97373597 ACATTCAAGCAGAGACTTAAGGG + Intronic
1194935941 X:99949112-99949134 ACTCTTCATCAGAAAATGAATGG + Intergenic
1195811305 X:108833614-108833636 AAATTGAAGCAGACACTGAAAGG - Intergenic
1196190603 X:112790471-112790493 ACACTTAGGCAGAAATTGGGGGG + Intronic
1196549784 X:117010057-117010079 AGACTTAAGCAAAGACTGGAGGG + Intergenic
1196566567 X:117212345-117212367 ACACATATGCTGAAAGTGAAGGG + Intergenic
1197022039 X:121702977-121702999 ACACATAGACAGAAAGTGAAGGG - Intergenic
1197204732 X:123779972-123779994 ACACTTCAGCAAAAACTTAAAGG + Intergenic
1197387999 X:125824661-125824683 AAAATTAAGAAGAAAATGAAAGG - Intergenic
1197407940 X:126076612-126076634 TCAATCAAGTAGAAACTGAATGG - Intergenic
1198061499 X:133049584-133049606 ACACATACACAGAGACTGAATGG + Intronic
1199094989 X:143727437-143727459 ACACATAGGCTGAAAATGAAGGG + Intergenic
1199135888 X:144252580-144252602 ACACTTAAACAAAAAATGGAAGG + Intergenic
1199503764 X:148538317-148538339 ACACTGAAGCAGAGACTCTAGGG - Intronic