ID: 1102589815 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 12:113948795-113948817 |
| Sequence | CCGGGCCGTGGATAGCCCAG CGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 74 | |||
| Summary | {0: 1, 1: 0, 2: 0, 3: 3, 4: 70} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1102589815_1102589821 | 1 | Left | 1102589815 | 12:113948795-113948817 | CCGCTGGGCTATCCACGGCCCGG | 0: 1 1: 0 2: 0 3: 3 4: 70 |
||
| Right | 1102589821 | 12:113948819-113948841 | GGCCACACCCCTACCATATTTGG | 0: 1 1: 0 2: 0 3: 6 4: 123 |
||||
| 1102589815_1102589827 | 28 | Left | 1102589815 | 12:113948795-113948817 | CCGCTGGGCTATCCACGGCCCGG | 0: 1 1: 0 2: 0 3: 3 4: 70 |
||
| Right | 1102589827 | 12:113948846-113948868 | GAGCTTCTCCAGATCCTCCTCGG | 0: 1 1: 0 2: 8 3: 24 4: 214 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1102589815 | Original CRISPR | CCGGGCCGTGGATAGCCCAG CGG (reversed) | Intronic | ||