ID: 1102589818

View in Genome Browser
Species Human (GRCh38)
Location 12:113948807-113948829
Sequence GGGGTGTGGCCTCCGGGCCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 326
Summary {0: 1, 1: 1, 2: 1, 3: 21, 4: 302}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102589818_1102589827 16 Left 1102589818 12:113948807-113948829 CCACGGCCCGGAGGCCACACCCC 0: 1
1: 1
2: 1
3: 21
4: 302
Right 1102589827 12:113948846-113948868 GAGCTTCTCCAGATCCTCCTCGG 0: 1
1: 0
2: 8
3: 24
4: 214
1102589818_1102589828 22 Left 1102589818 12:113948807-113948829 CCACGGCCCGGAGGCCACACCCC 0: 1
1: 1
2: 1
3: 21
4: 302
Right 1102589828 12:113948852-113948874 CTCCAGATCCTCCTCGGTGCTGG 0: 1
1: 0
2: 1
3: 18
4: 172
1102589818_1102589830 28 Left 1102589818 12:113948807-113948829 CCACGGCCCGGAGGCCACACCCC 0: 1
1: 1
2: 1
3: 21
4: 302
Right 1102589830 12:113948858-113948880 ATCCTCCTCGGTGCTGGTGTAGG 0: 1
1: 0
2: 0
3: 8
4: 118
1102589818_1102589831 29 Left 1102589818 12:113948807-113948829 CCACGGCCCGGAGGCCACACCCC 0: 1
1: 1
2: 1
3: 21
4: 302
Right 1102589831 12:113948859-113948881 TCCTCCTCGGTGCTGGTGTAGGG 0: 1
1: 0
2: 0
3: 5
4: 102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102589818 Original CRISPR GGGGTGTGGCCTCCGGGCCG TGG (reversed) Intronic