ID: 1102589819

View in Genome Browser
Species Human (GRCh38)
Location 12:113948813-113948835
Sequence ATGGTAGGGGTGTGGCCTCC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 215
Summary {0: 1, 1: 0, 2: 3, 3: 18, 4: 193}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102589819_1102589831 23 Left 1102589819 12:113948813-113948835 CCCGGAGGCCACACCCCTACCAT 0: 1
1: 0
2: 3
3: 18
4: 193
Right 1102589831 12:113948859-113948881 TCCTCCTCGGTGCTGGTGTAGGG 0: 1
1: 0
2: 0
3: 5
4: 102
1102589819_1102589827 10 Left 1102589819 12:113948813-113948835 CCCGGAGGCCACACCCCTACCAT 0: 1
1: 0
2: 3
3: 18
4: 193
Right 1102589827 12:113948846-113948868 GAGCTTCTCCAGATCCTCCTCGG 0: 1
1: 0
2: 8
3: 24
4: 214
1102589819_1102589834 27 Left 1102589819 12:113948813-113948835 CCCGGAGGCCACACCCCTACCAT 0: 1
1: 0
2: 3
3: 18
4: 193
Right 1102589834 12:113948863-113948885 CCTCGGTGCTGGTGTAGGGCAGG 0: 1
1: 0
2: 1
3: 11
4: 184
1102589819_1102589828 16 Left 1102589819 12:113948813-113948835 CCCGGAGGCCACACCCCTACCAT 0: 1
1: 0
2: 3
3: 18
4: 193
Right 1102589828 12:113948852-113948874 CTCCAGATCCTCCTCGGTGCTGG 0: 1
1: 0
2: 1
3: 18
4: 172
1102589819_1102589830 22 Left 1102589819 12:113948813-113948835 CCCGGAGGCCACACCCCTACCAT 0: 1
1: 0
2: 3
3: 18
4: 193
Right 1102589830 12:113948858-113948880 ATCCTCCTCGGTGCTGGTGTAGG 0: 1
1: 0
2: 0
3: 8
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102589819 Original CRISPR ATGGTAGGGGTGTGGCCTCC GGG (reversed) Exonic