ID: 1102589822

View in Genome Browser
Species Human (GRCh38)
Location 12:113948821-113948843
Sequence CTCCAAATATGGTAGGGGTG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 152}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102589822_1102589834 19 Left 1102589822 12:113948821-113948843 CCACACCCCTACCATATTTGGAG 0: 1
1: 0
2: 2
3: 12
4: 152
Right 1102589834 12:113948863-113948885 CCTCGGTGCTGGTGTAGGGCAGG 0: 1
1: 0
2: 1
3: 11
4: 184
1102589822_1102589830 14 Left 1102589822 12:113948821-113948843 CCACACCCCTACCATATTTGGAG 0: 1
1: 0
2: 2
3: 12
4: 152
Right 1102589830 12:113948858-113948880 ATCCTCCTCGGTGCTGGTGTAGG 0: 1
1: 0
2: 0
3: 8
4: 118
1102589822_1102589831 15 Left 1102589822 12:113948821-113948843 CCACACCCCTACCATATTTGGAG 0: 1
1: 0
2: 2
3: 12
4: 152
Right 1102589831 12:113948859-113948881 TCCTCCTCGGTGCTGGTGTAGGG 0: 1
1: 0
2: 0
3: 5
4: 102
1102589822_1102589827 2 Left 1102589822 12:113948821-113948843 CCACACCCCTACCATATTTGGAG 0: 1
1: 0
2: 2
3: 12
4: 152
Right 1102589827 12:113948846-113948868 GAGCTTCTCCAGATCCTCCTCGG 0: 1
1: 0
2: 8
3: 24
4: 214
1102589822_1102589828 8 Left 1102589822 12:113948821-113948843 CCACACCCCTACCATATTTGGAG 0: 1
1: 0
2: 2
3: 12
4: 152
Right 1102589828 12:113948852-113948874 CTCCAGATCCTCCTCGGTGCTGG 0: 1
1: 0
2: 1
3: 18
4: 172

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102589822 Original CRISPR CTCCAAATATGGTAGGGGTG TGG (reversed) Exonic