ID: 1102589826

View in Genome Browser
Species Human (GRCh38)
Location 12:113948832-113948854
Sequence GAGAAGCTCTTCTCCAAATA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 1, 2: 0, 3: 16, 4: 166}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102589826_1102589828 -3 Left 1102589826 12:113948832-113948854 CCATATTTGGAGAAGAGCTTCTC 0: 1
1: 1
2: 0
3: 16
4: 166
Right 1102589828 12:113948852-113948874 CTCCAGATCCTCCTCGGTGCTGG 0: 1
1: 0
2: 1
3: 18
4: 172
1102589826_1102589830 3 Left 1102589826 12:113948832-113948854 CCATATTTGGAGAAGAGCTTCTC 0: 1
1: 1
2: 0
3: 16
4: 166
Right 1102589830 12:113948858-113948880 ATCCTCCTCGGTGCTGGTGTAGG 0: 1
1: 0
2: 0
3: 8
4: 118
1102589826_1102589834 8 Left 1102589826 12:113948832-113948854 CCATATTTGGAGAAGAGCTTCTC 0: 1
1: 1
2: 0
3: 16
4: 166
Right 1102589834 12:113948863-113948885 CCTCGGTGCTGGTGTAGGGCAGG 0: 1
1: 0
2: 1
3: 11
4: 184
1102589826_1102589835 30 Left 1102589826 12:113948832-113948854 CCATATTTGGAGAAGAGCTTCTC 0: 1
1: 1
2: 0
3: 16
4: 166
Right 1102589835 12:113948885-113948907 GTTCCGTACAAAGAGCCTTCCGG 0: 1
1: 0
2: 0
3: 0
4: 38
1102589826_1102589831 4 Left 1102589826 12:113948832-113948854 CCATATTTGGAGAAGAGCTTCTC 0: 1
1: 1
2: 0
3: 16
4: 166
Right 1102589831 12:113948859-113948881 TCCTCCTCGGTGCTGGTGTAGGG 0: 1
1: 0
2: 0
3: 5
4: 102
1102589826_1102589827 -9 Left 1102589826 12:113948832-113948854 CCATATTTGGAGAAGAGCTTCTC 0: 1
1: 1
2: 0
3: 16
4: 166
Right 1102589827 12:113948846-113948868 GAGCTTCTCCAGATCCTCCTCGG 0: 1
1: 0
2: 8
3: 24
4: 214

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102589826 Original CRISPR GAGAAGCTCTTCTCCAAATA TGG (reversed) Exonic