ID: 1102589827

View in Genome Browser
Species Human (GRCh38)
Location 12:113948846-113948868
Sequence GAGCTTCTCCAGATCCTCCT CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 247
Summary {0: 1, 1: 0, 2: 8, 3: 24, 4: 214}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102589815_1102589827 28 Left 1102589815 12:113948795-113948817 CCGCTGGGCTATCCACGGCCCGG 0: 1
1: 0
2: 0
3: 3
4: 70
Right 1102589827 12:113948846-113948868 GAGCTTCTCCAGATCCTCCTCGG 0: 1
1: 0
2: 8
3: 24
4: 214
1102589820_1102589827 9 Left 1102589820 12:113948814-113948836 CCGGAGGCCACACCCCTACCATA 0: 1
1: 0
2: 1
3: 10
4: 183
Right 1102589827 12:113948846-113948868 GAGCTTCTCCAGATCCTCCTCGG 0: 1
1: 0
2: 8
3: 24
4: 214
1102589825_1102589827 -5 Left 1102589825 12:113948828-113948850 CCTACCATATTTGGAGAAGAGCT 0: 1
1: 0
2: 1
3: 12
4: 141
Right 1102589827 12:113948846-113948868 GAGCTTCTCCAGATCCTCCTCGG 0: 1
1: 0
2: 8
3: 24
4: 214
1102589818_1102589827 16 Left 1102589818 12:113948807-113948829 CCACGGCCCGGAGGCCACACCCC 0: 1
1: 1
2: 1
3: 21
4: 302
Right 1102589827 12:113948846-113948868 GAGCTTCTCCAGATCCTCCTCGG 0: 1
1: 0
2: 8
3: 24
4: 214
1102589824_1102589827 -4 Left 1102589824 12:113948827-113948849 CCCTACCATATTTGGAGAAGAGC 0: 1
1: 0
2: 0
3: 11
4: 97
Right 1102589827 12:113948846-113948868 GAGCTTCTCCAGATCCTCCTCGG 0: 1
1: 0
2: 8
3: 24
4: 214
1102589823_1102589827 -3 Left 1102589823 12:113948826-113948848 CCCCTACCATATTTGGAGAAGAG 0: 1
1: 0
2: 0
3: 15
4: 136
Right 1102589827 12:113948846-113948868 GAGCTTCTCCAGATCCTCCTCGG 0: 1
1: 0
2: 8
3: 24
4: 214
1102589819_1102589827 10 Left 1102589819 12:113948813-113948835 CCCGGAGGCCACACCCCTACCAT 0: 1
1: 0
2: 3
3: 18
4: 193
Right 1102589827 12:113948846-113948868 GAGCTTCTCCAGATCCTCCTCGG 0: 1
1: 0
2: 8
3: 24
4: 214
1102589822_1102589827 2 Left 1102589822 12:113948821-113948843 CCACACCCCTACCATATTTGGAG 0: 1
1: 0
2: 2
3: 12
4: 152
Right 1102589827 12:113948846-113948868 GAGCTTCTCCAGATCCTCCTCGG 0: 1
1: 0
2: 8
3: 24
4: 214
1102589826_1102589827 -9 Left 1102589826 12:113948832-113948854 CCATATTTGGAGAAGAGCTTCTC 0: 1
1: 1
2: 0
3: 16
4: 166
Right 1102589827 12:113948846-113948868 GAGCTTCTCCAGATCCTCCTCGG 0: 1
1: 0
2: 8
3: 24
4: 214

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102589827 Original CRISPR GAGCTTCTCCAGATCCTCCT CGG Exonic