ID: 1102589834

View in Genome Browser
Species Human (GRCh38)
Location 12:113948863-113948885
Sequence CCTCGGTGCTGGTGTAGGGC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 184}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102589824_1102589834 13 Left 1102589824 12:113948827-113948849 CCCTACCATATTTGGAGAAGAGC 0: 1
1: 0
2: 0
3: 11
4: 97
Right 1102589834 12:113948863-113948885 CCTCGGTGCTGGTGTAGGGCAGG 0: 1
1: 0
2: 1
3: 11
4: 184
1102589820_1102589834 26 Left 1102589820 12:113948814-113948836 CCGGAGGCCACACCCCTACCATA 0: 1
1: 0
2: 1
3: 10
4: 183
Right 1102589834 12:113948863-113948885 CCTCGGTGCTGGTGTAGGGCAGG 0: 1
1: 0
2: 1
3: 11
4: 184
1102589826_1102589834 8 Left 1102589826 12:113948832-113948854 CCATATTTGGAGAAGAGCTTCTC 0: 1
1: 1
2: 0
3: 16
4: 166
Right 1102589834 12:113948863-113948885 CCTCGGTGCTGGTGTAGGGCAGG 0: 1
1: 0
2: 1
3: 11
4: 184
1102589819_1102589834 27 Left 1102589819 12:113948813-113948835 CCCGGAGGCCACACCCCTACCAT 0: 1
1: 0
2: 3
3: 18
4: 193
Right 1102589834 12:113948863-113948885 CCTCGGTGCTGGTGTAGGGCAGG 0: 1
1: 0
2: 1
3: 11
4: 184
1102589822_1102589834 19 Left 1102589822 12:113948821-113948843 CCACACCCCTACCATATTTGGAG 0: 1
1: 0
2: 2
3: 12
4: 152
Right 1102589834 12:113948863-113948885 CCTCGGTGCTGGTGTAGGGCAGG 0: 1
1: 0
2: 1
3: 11
4: 184
1102589823_1102589834 14 Left 1102589823 12:113948826-113948848 CCCCTACCATATTTGGAGAAGAG 0: 1
1: 0
2: 0
3: 15
4: 136
Right 1102589834 12:113948863-113948885 CCTCGGTGCTGGTGTAGGGCAGG 0: 1
1: 0
2: 1
3: 11
4: 184
1102589825_1102589834 12 Left 1102589825 12:113948828-113948850 CCTACCATATTTGGAGAAGAGCT 0: 1
1: 0
2: 1
3: 12
4: 141
Right 1102589834 12:113948863-113948885 CCTCGGTGCTGGTGTAGGGCAGG 0: 1
1: 0
2: 1
3: 11
4: 184

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102589834 Original CRISPR CCTCGGTGCTGGTGTAGGGC AGG Exonic