ID: 1102599207

View in Genome Browser
Species Human (GRCh38)
Location 12:114016239-114016261
Sequence CAGGAGAACAGGAGGGAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102599193_1102599207 22 Left 1102599193 12:114016194-114016216 CCAGGAGGACCAAGGAGGTGAGG No data
Right 1102599207 12:114016239-114016261 CAGGAGAACAGGAGGGAAGAGGG No data
1102599197_1102599207 -2 Left 1102599197 12:114016218-114016240 CCTGCAATCCACATGCCTGCCCA No data
Right 1102599207 12:114016239-114016261 CAGGAGAACAGGAGGGAAGAGGG No data
1102599192_1102599207 23 Left 1102599192 12:114016193-114016215 CCCAGGAGGACCAAGGAGGTGAG No data
Right 1102599207 12:114016239-114016261 CAGGAGAACAGGAGGGAAGAGGG No data
1102599196_1102599207 -1 Left 1102599196 12:114016217-114016239 CCCTGCAATCCACATGCCTGCCC No data
Right 1102599207 12:114016239-114016261 CAGGAGAACAGGAGGGAAGAGGG No data
1102599195_1102599207 13 Left 1102599195 12:114016203-114016225 CCAAGGAGGTGAGGCCCTGCAAT No data
Right 1102599207 12:114016239-114016261 CAGGAGAACAGGAGGGAAGAGGG No data
1102599199_1102599207 -10 Left 1102599199 12:114016226-114016248 CCACATGCCTGCCCAGGAGAACA No data
Right 1102599207 12:114016239-114016261 CAGGAGAACAGGAGGGAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102599207 Original CRISPR CAGGAGAACAGGAGGGAAGA GGG Intergenic
No off target data available for this crispr