ID: 1102599970

View in Genome Browser
Species Human (GRCh38)
Location 12:114022247-114022269
Sequence TAGGGGACTTCCGAGGTGAT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102599970_1102599979 16 Left 1102599970 12:114022247-114022269 CCGATCACCTCGGAAGTCCCCTA No data
Right 1102599979 12:114022286-114022308 GATCTTCAGACAGGAATGTCAGG No data
1102599970_1102599977 7 Left 1102599970 12:114022247-114022269 CCGATCACCTCGGAAGTCCCCTA No data
Right 1102599977 12:114022277-114022299 ATGGATGCCGATCTTCAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102599970 Original CRISPR TAGGGGACTTCCGAGGTGAT CGG (reversed) Intergenic
No off target data available for this crispr