ID: 1102601199

View in Genome Browser
Species Human (GRCh38)
Location 12:114032149-114032171
Sequence CACTGTAAGCAGCTCTAGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102601195_1102601199 18 Left 1102601195 12:114032108-114032130 CCCATTTGCCTTGGGAAGGTTGT No data
Right 1102601199 12:114032149-114032171 CACTGTAAGCAGCTCTAGCAAGG No data
1102601196_1102601199 17 Left 1102601196 12:114032109-114032131 CCATTTGCCTTGGGAAGGTTGTA No data
Right 1102601199 12:114032149-114032171 CACTGTAAGCAGCTCTAGCAAGG No data
1102601193_1102601199 23 Left 1102601193 12:114032103-114032125 CCTTTCCCATTTGCCTTGGGAAG No data
Right 1102601199 12:114032149-114032171 CACTGTAAGCAGCTCTAGCAAGG No data
1102601197_1102601199 10 Left 1102601197 12:114032116-114032138 CCTTGGGAAGGTTGTAAAGTACA No data
Right 1102601199 12:114032149-114032171 CACTGTAAGCAGCTCTAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102601199 Original CRISPR CACTGTAAGCAGCTCTAGCA AGG Intergenic
No off target data available for this crispr