ID: 1102602076

View in Genome Browser
Species Human (GRCh38)
Location 12:114039050-114039072
Sequence TTAAACAGCCTAACATTTCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102602073_1102602076 22 Left 1102602073 12:114039005-114039027 CCATTTTACAGATGAAAAAACTG 0: 33
1: 825
2: 4097
3: 10145
4: 17518
Right 1102602076 12:114039050-114039072 TTAAACAGCCTAACATTTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102602076 Original CRISPR TTAAACAGCCTAACATTTCT AGG Intergenic
No off target data available for this crispr