ID: 1102602463

View in Genome Browser
Species Human (GRCh38)
Location 12:114042368-114042390
Sequence AGCCTTCATTAGGAAGAAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102602463_1102602469 28 Left 1102602463 12:114042368-114042390 CCAGTTTCTTCCTAATGAAGGCT No data
Right 1102602469 12:114042419-114042441 GCCCTACATTGATTTGATTCAGG No data
1102602463_1102602471 29 Left 1102602463 12:114042368-114042390 CCAGTTTCTTCCTAATGAAGGCT No data
Right 1102602471 12:114042420-114042442 CCCTACATTGATTTGATTCAGGG No data
1102602463_1102602466 3 Left 1102602463 12:114042368-114042390 CCAGTTTCTTCCTAATGAAGGCT No data
Right 1102602466 12:114042394-114042416 AGGAACATCCTTGTTCATTCTGG No data
1102602463_1102602467 4 Left 1102602463 12:114042368-114042390 CCAGTTTCTTCCTAATGAAGGCT No data
Right 1102602467 12:114042395-114042417 GGAACATCCTTGTTCATTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102602463 Original CRISPR AGCCTTCATTAGGAAGAAAC TGG (reversed) Intergenic
No off target data available for this crispr