ID: 1102602465

View in Genome Browser
Species Human (GRCh38)
Location 12:114042378-114042400
Sequence TGTTCCTTGTAGCCTTCATT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102602465_1102602474 26 Left 1102602465 12:114042378-114042400 CCTAATGAAGGCTACAAGGAACA No data
Right 1102602474 12:114042427-114042449 TTGATTTGATTCAGGGTAGAGGG No data
1102602465_1102602469 18 Left 1102602465 12:114042378-114042400 CCTAATGAAGGCTACAAGGAACA No data
Right 1102602469 12:114042419-114042441 GCCCTACATTGATTTGATTCAGG No data
1102602465_1102602475 27 Left 1102602465 12:114042378-114042400 CCTAATGAAGGCTACAAGGAACA No data
Right 1102602475 12:114042428-114042450 TGATTTGATTCAGGGTAGAGGGG No data
1102602465_1102602473 25 Left 1102602465 12:114042378-114042400 CCTAATGAAGGCTACAAGGAACA No data
Right 1102602473 12:114042426-114042448 ATTGATTTGATTCAGGGTAGAGG No data
1102602465_1102602467 -6 Left 1102602465 12:114042378-114042400 CCTAATGAAGGCTACAAGGAACA No data
Right 1102602467 12:114042395-114042417 GGAACATCCTTGTTCATTCTGGG No data
1102602465_1102602466 -7 Left 1102602465 12:114042378-114042400 CCTAATGAAGGCTACAAGGAACA No data
Right 1102602466 12:114042394-114042416 AGGAACATCCTTGTTCATTCTGG No data
1102602465_1102602471 19 Left 1102602465 12:114042378-114042400 CCTAATGAAGGCTACAAGGAACA No data
Right 1102602471 12:114042420-114042442 CCCTACATTGATTTGATTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102602465 Original CRISPR TGTTCCTTGTAGCCTTCATT AGG (reversed) Intergenic
No off target data available for this crispr