ID: 1102602468

View in Genome Browser
Species Human (GRCh38)
Location 12:114042402-114042424
Sequence TAGGGCTCCCAGAATGAACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102602468_1102602474 2 Left 1102602468 12:114042402-114042424 CCTTGTTCATTCTGGGAGCCCTA No data
Right 1102602474 12:114042427-114042449 TTGATTTGATTCAGGGTAGAGGG No data
1102602468_1102602473 1 Left 1102602468 12:114042402-114042424 CCTTGTTCATTCTGGGAGCCCTA No data
Right 1102602473 12:114042426-114042448 ATTGATTTGATTCAGGGTAGAGG No data
1102602468_1102602471 -5 Left 1102602468 12:114042402-114042424 CCTTGTTCATTCTGGGAGCCCTA No data
Right 1102602471 12:114042420-114042442 CCCTACATTGATTTGATTCAGGG No data
1102602468_1102602469 -6 Left 1102602468 12:114042402-114042424 CCTTGTTCATTCTGGGAGCCCTA No data
Right 1102602469 12:114042419-114042441 GCCCTACATTGATTTGATTCAGG No data
1102602468_1102602477 14 Left 1102602468 12:114042402-114042424 CCTTGTTCATTCTGGGAGCCCTA No data
Right 1102602477 12:114042439-114042461 AGGGTAGAGGGGCTTAGGTCAGG No data
1102602468_1102602476 9 Left 1102602468 12:114042402-114042424 CCTTGTTCATTCTGGGAGCCCTA No data
Right 1102602476 12:114042434-114042456 GATTCAGGGTAGAGGGGCTTAGG No data
1102602468_1102602475 3 Left 1102602468 12:114042402-114042424 CCTTGTTCATTCTGGGAGCCCTA No data
Right 1102602475 12:114042428-114042450 TGATTTGATTCAGGGTAGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102602468 Original CRISPR TAGGGCTCCCAGAATGAACA AGG (reversed) Intergenic
No off target data available for this crispr