ID: 1102602469

View in Genome Browser
Species Human (GRCh38)
Location 12:114042419-114042441
Sequence GCCCTACATTGATTTGATTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102602468_1102602469 -6 Left 1102602468 12:114042402-114042424 CCTTGTTCATTCTGGGAGCCCTA No data
Right 1102602469 12:114042419-114042441 GCCCTACATTGATTTGATTCAGG No data
1102602465_1102602469 18 Left 1102602465 12:114042378-114042400 CCTAATGAAGGCTACAAGGAACA No data
Right 1102602469 12:114042419-114042441 GCCCTACATTGATTTGATTCAGG No data
1102602463_1102602469 28 Left 1102602463 12:114042368-114042390 CCAGTTTCTTCCTAATGAAGGCT No data
Right 1102602469 12:114042419-114042441 GCCCTACATTGATTTGATTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102602469 Original CRISPR GCCCTACATTGATTTGATTC AGG Intergenic
No off target data available for this crispr