ID: 1102602470

View in Genome Browser
Species Human (GRCh38)
Location 12:114042420-114042442
Sequence CCCTGAATCAAATCAATGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102602470_1102602477 -4 Left 1102602470 12:114042420-114042442 CCCTACATTGATTTGATTCAGGG No data
Right 1102602477 12:114042439-114042461 AGGGTAGAGGGGCTTAGGTCAGG No data
1102602470_1102602476 -9 Left 1102602470 12:114042420-114042442 CCCTACATTGATTTGATTCAGGG No data
Right 1102602476 12:114042434-114042456 GATTCAGGGTAGAGGGGCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102602470 Original CRISPR CCCTGAATCAAATCAATGTA GGG (reversed) Intergenic
No off target data available for this crispr