ID: 1102602471

View in Genome Browser
Species Human (GRCh38)
Location 12:114042420-114042442
Sequence CCCTACATTGATTTGATTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102602463_1102602471 29 Left 1102602463 12:114042368-114042390 CCAGTTTCTTCCTAATGAAGGCT No data
Right 1102602471 12:114042420-114042442 CCCTACATTGATTTGATTCAGGG No data
1102602465_1102602471 19 Left 1102602465 12:114042378-114042400 CCTAATGAAGGCTACAAGGAACA No data
Right 1102602471 12:114042420-114042442 CCCTACATTGATTTGATTCAGGG No data
1102602468_1102602471 -5 Left 1102602468 12:114042402-114042424 CCTTGTTCATTCTGGGAGCCCTA No data
Right 1102602471 12:114042420-114042442 CCCTACATTGATTTGATTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102602471 Original CRISPR CCCTACATTGATTTGATTCA GGG Intergenic
No off target data available for this crispr