ID: 1102602476

View in Genome Browser
Species Human (GRCh38)
Location 12:114042434-114042456
Sequence GATTCAGGGTAGAGGGGCTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102602472_1102602476 -10 Left 1102602472 12:114042421-114042443 CCTACATTGATTTGATTCAGGGT No data
Right 1102602476 12:114042434-114042456 GATTCAGGGTAGAGGGGCTTAGG No data
1102602468_1102602476 9 Left 1102602468 12:114042402-114042424 CCTTGTTCATTCTGGGAGCCCTA No data
Right 1102602476 12:114042434-114042456 GATTCAGGGTAGAGGGGCTTAGG No data
1102602470_1102602476 -9 Left 1102602470 12:114042420-114042442 CCCTACATTGATTTGATTCAGGG No data
Right 1102602476 12:114042434-114042456 GATTCAGGGTAGAGGGGCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102602476 Original CRISPR GATTCAGGGTAGAGGGGCTT AGG Intergenic
No off target data available for this crispr