ID: 1102602815

View in Genome Browser
Species Human (GRCh38)
Location 12:114045609-114045631
Sequence GCCATGACGGGTGTGCTTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102602815_1102602820 14 Left 1102602815 12:114045609-114045631 CCTGGAAGCACACCCGTCATGGC No data
Right 1102602820 12:114045646-114045668 CAGATGCCAGCTGAAAACAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102602815 Original CRISPR GCCATGACGGGTGTGCTTCC AGG (reversed) Intergenic
No off target data available for this crispr