ID: 1102602820

View in Genome Browser
Species Human (GRCh38)
Location 12:114045646-114045668
Sequence CAGATGCCAGCTGAAAACAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102602817_1102602820 1 Left 1102602817 12:114045622-114045644 CCGTCATGGCTTTGAAATCCACC No data
Right 1102602820 12:114045646-114045668 CAGATGCCAGCTGAAAACAGAGG No data
1102602813_1102602820 26 Left 1102602813 12:114045597-114045619 CCGGGTCGTAAGCCTGGAAGCAC No data
Right 1102602820 12:114045646-114045668 CAGATGCCAGCTGAAAACAGAGG No data
1102602816_1102602820 2 Left 1102602816 12:114045621-114045643 CCCGTCATGGCTTTGAAATCCAC No data
Right 1102602820 12:114045646-114045668 CAGATGCCAGCTGAAAACAGAGG No data
1102602815_1102602820 14 Left 1102602815 12:114045609-114045631 CCTGGAAGCACACCCGTCATGGC No data
Right 1102602820 12:114045646-114045668 CAGATGCCAGCTGAAAACAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102602820 Original CRISPR CAGATGCCAGCTGAAAACAG AGG Intergenic
No off target data available for this crispr