ID: 1102605046

View in Genome Browser
Species Human (GRCh38)
Location 12:114061850-114061872
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102605046_1102605048 -4 Left 1102605046 12:114061850-114061872 CCCATGAATAGCAGTGAAAGGTT No data
Right 1102605048 12:114061869-114061891 GGTTACTTGTAGACACTATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102605046 Original CRISPR AACCTTTCACTGCTATTCAT GGG (reversed) Intergenic
No off target data available for this crispr