ID: 1102607581

View in Genome Browser
Species Human (GRCh38)
Location 12:114080511-114080533
Sequence CATTCTCACCAGAGAGTGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102607581_1102607586 14 Left 1102607581 12:114080511-114080533 CCCACCACTCTCTGGTGAGAATG No data
Right 1102607586 12:114080548-114080570 AGTCACTTGTGCAAACAATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102607581 Original CRISPR CATTCTCACCAGAGAGTGGT GGG (reversed) Intergenic
No off target data available for this crispr