ID: 1102610816

View in Genome Browser
Species Human (GRCh38)
Location 12:114110571-114110593
Sequence GAATGTGACAGAAGCATGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102610812_1102610816 27 Left 1102610812 12:114110521-114110543 CCAGGTTAGTCATCTTTAGTTAA 0: 1
1: 0
2: 0
3: 7
4: 108
Right 1102610816 12:114110571-114110593 GAATGTGACAGAAGCATGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102610816 Original CRISPR GAATGTGACAGAAGCATGGA AGG Intergenic
No off target data available for this crispr