ID: 1102611779

View in Genome Browser
Species Human (GRCh38)
Location 12:114118704-114118726
Sequence GCCGCCGGAATGGGAGTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102611773_1102611779 11 Left 1102611773 12:114118670-114118692 CCTAAGAAATTTGAGGTCAGGAG No data
Right 1102611779 12:114118704-114118726 GCCGCCGGAATGGGAGTGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102611779 Original CRISPR GCCGCCGGAATGGGAGTGGG TGG Intergenic
No off target data available for this crispr