ID: 1102616071

View in Genome Browser
Species Human (GRCh38)
Location 12:114155376-114155398
Sequence ATCAGTTACAACTTCAGGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102616068_1102616071 2 Left 1102616068 12:114155351-114155373 CCTGGTTTAGGGCCTCACGTTTA No data
Right 1102616071 12:114155376-114155398 ATCAGTTACAACTTCAGGAAAGG No data
1102616069_1102616071 -10 Left 1102616069 12:114155363-114155385 CCTCACGTTTATAATCAGTTACA No data
Right 1102616071 12:114155376-114155398 ATCAGTTACAACTTCAGGAAAGG No data
1102616067_1102616071 8 Left 1102616067 12:114155345-114155367 CCTATTCCTGGTTTAGGGCCTCA No data
Right 1102616071 12:114155376-114155398 ATCAGTTACAACTTCAGGAAAGG No data
1102616063_1102616071 22 Left 1102616063 12:114155331-114155353 CCTAACTCAGGCAACCTATTCCT No data
Right 1102616071 12:114155376-114155398 ATCAGTTACAACTTCAGGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102616071 Original CRISPR ATCAGTTACAACTTCAGGAA AGG Intergenic
No off target data available for this crispr