ID: 1102616452

View in Genome Browser
Species Human (GRCh38)
Location 12:114158710-114158732
Sequence GATTCCTACTGAAGACTAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102616450_1102616452 14 Left 1102616450 12:114158673-114158695 CCCATGGACATAATTAAAGTTAA No data
Right 1102616452 12:114158710-114158732 GATTCCTACTGAAGACTAGCAGG No data
1102616448_1102616452 27 Left 1102616448 12:114158660-114158682 CCCTTGAGGGTGGCCCATGGACA No data
Right 1102616452 12:114158710-114158732 GATTCCTACTGAAGACTAGCAGG No data
1102616451_1102616452 13 Left 1102616451 12:114158674-114158696 CCATGGACATAATTAAAGTTAAA No data
Right 1102616452 12:114158710-114158732 GATTCCTACTGAAGACTAGCAGG No data
1102616449_1102616452 26 Left 1102616449 12:114158661-114158683 CCTTGAGGGTGGCCCATGGACAT No data
Right 1102616452 12:114158710-114158732 GATTCCTACTGAAGACTAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102616452 Original CRISPR GATTCCTACTGAAGACTAGC AGG Intergenic
No off target data available for this crispr