ID: 1102621215

View in Genome Browser
Species Human (GRCh38)
Location 12:114196286-114196308
Sequence CCTTTTCAAGGGAATCATTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102621211_1102621215 0 Left 1102621211 12:114196263-114196285 CCAATTTAAGTGATTCACTGCAG No data
Right 1102621215 12:114196286-114196308 CCTTTTCAAGGGAATCATTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102621215 Original CRISPR CCTTTTCAAGGGAATCATTA AGG Intergenic
No off target data available for this crispr