ID: 1102622096

View in Genome Browser
Species Human (GRCh38)
Location 12:114204240-114204262
Sequence AGGGCCAACCTGACTGGGAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102622096_1102622112 27 Left 1102622096 12:114204240-114204262 CCAATCCCAGTCAGGTTGGCCCT No data
Right 1102622112 12:114204290-114204312 TTTTGTAGGGTGTTGCGGGGGGG No data
1102622096_1102622113 28 Left 1102622096 12:114204240-114204262 CCAATCCCAGTCAGGTTGGCCCT No data
Right 1102622113 12:114204291-114204313 TTTGTAGGGTGTTGCGGGGGGGG No data
1102622096_1102622108 23 Left 1102622096 12:114204240-114204262 CCAATCCCAGTCAGGTTGGCCCT No data
Right 1102622108 12:114204286-114204308 AATTTTTTGTAGGGTGTTGCGGG No data
1102622096_1102622111 26 Left 1102622096 12:114204240-114204262 CCAATCCCAGTCAGGTTGGCCCT No data
Right 1102622111 12:114204289-114204311 TTTTTGTAGGGTGTTGCGGGGGG No data
1102622096_1102622110 25 Left 1102622096 12:114204240-114204262 CCAATCCCAGTCAGGTTGGCCCT No data
Right 1102622110 12:114204288-114204310 TTTTTTGTAGGGTGTTGCGGGGG No data
1102622096_1102622104 14 Left 1102622096 12:114204240-114204262 CCAATCCCAGTCAGGTTGGCCCT No data
Right 1102622104 12:114204277-114204299 CAGATCCCGAATTTTTTGTAGGG No data
1102622096_1102622109 24 Left 1102622096 12:114204240-114204262 CCAATCCCAGTCAGGTTGGCCCT No data
Right 1102622109 12:114204287-114204309 ATTTTTTGTAGGGTGTTGCGGGG No data
1102622096_1102622103 13 Left 1102622096 12:114204240-114204262 CCAATCCCAGTCAGGTTGGCCCT No data
Right 1102622103 12:114204276-114204298 CCAGATCCCGAATTTTTTGTAGG No data
1102622096_1102622107 22 Left 1102622096 12:114204240-114204262 CCAATCCCAGTCAGGTTGGCCCT No data
Right 1102622107 12:114204285-114204307 GAATTTTTTGTAGGGTGTTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102622096 Original CRISPR AGGGCCAACCTGACTGGGAT TGG (reversed) Intergenic
No off target data available for this crispr