ID: 1102624635

View in Genome Browser
Species Human (GRCh38)
Location 12:114225188-114225210
Sequence GACCCCTGACCCCAGATCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102624635_1102624641 29 Left 1102624635 12:114225188-114225210 CCACTGATCTGGGGTCAGGGGTC No data
Right 1102624641 12:114225240-114225262 GCAGCAACCACAGGCTGACAAGG No data
1102624635_1102624640 20 Left 1102624635 12:114225188-114225210 CCACTGATCTGGGGTCAGGGGTC No data
Right 1102624640 12:114225231-114225253 GCTGAGTAAGCAGCAACCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102624635 Original CRISPR GACCCCTGACCCCAGATCAG TGG (reversed) Intergenic
No off target data available for this crispr