ID: 1102632491

View in Genome Browser
Species Human (GRCh38)
Location 12:114293497-114293519
Sequence GGCAATACCTGTTGTGTGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102632486_1102632491 16 Left 1102632486 12:114293458-114293480 CCAGATACATCTATACAAAATAA No data
Right 1102632491 12:114293497-114293519 GGCAATACCTGTTGTGTGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102632491 Original CRISPR GGCAATACCTGTTGTGTGCT AGG Intergenic
No off target data available for this crispr