ID: 1102633004

View in Genome Browser
Species Human (GRCh38)
Location 12:114298681-114298703
Sequence CAGAAGATGGAGGGGTTATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102633004_1102633011 2 Left 1102633004 12:114298681-114298703 CCAGATAACCCCTCCATCTTCTG No data
Right 1102633011 12:114298706-114298728 GGGAAGATCTACCTCCCCAGAGG No data
1102633004_1102633013 9 Left 1102633004 12:114298681-114298703 CCAGATAACCCCTCCATCTTCTG No data
Right 1102633013 12:114298713-114298735 TCTACCTCCCCAGAGGGACCTGG No data
1102633004_1102633019 29 Left 1102633004 12:114298681-114298703 CCAGATAACCCCTCCATCTTCTG No data
Right 1102633019 12:114298733-114298755 TGGCAAGCAGCTCCTATCATTGG No data
1102633004_1102633012 3 Left 1102633004 12:114298681-114298703 CCAGATAACCCCTCCATCTTCTG No data
Right 1102633012 12:114298707-114298729 GGAAGATCTACCTCCCCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102633004 Original CRISPR CAGAAGATGGAGGGGTTATC TGG (reversed) Intergenic
No off target data available for this crispr