ID: 1102633008

View in Genome Browser
Species Human (GRCh38)
Location 12:114298690-114298712
Sequence TCTTCCCTGCAGAAGATGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102633008_1102633011 -7 Left 1102633008 12:114298690-114298712 CCCTCCATCTTCTGCAGGGAAGA No data
Right 1102633011 12:114298706-114298728 GGGAAGATCTACCTCCCCAGAGG No data
1102633008_1102633013 0 Left 1102633008 12:114298690-114298712 CCCTCCATCTTCTGCAGGGAAGA No data
Right 1102633013 12:114298713-114298735 TCTACCTCCCCAGAGGGACCTGG No data
1102633008_1102633020 29 Left 1102633008 12:114298690-114298712 CCCTCCATCTTCTGCAGGGAAGA No data
Right 1102633020 12:114298742-114298764 GCTCCTATCATTGGCTTTGAAGG No data
1102633008_1102633019 20 Left 1102633008 12:114298690-114298712 CCCTCCATCTTCTGCAGGGAAGA No data
Right 1102633019 12:114298733-114298755 TGGCAAGCAGCTCCTATCATTGG No data
1102633008_1102633012 -6 Left 1102633008 12:114298690-114298712 CCCTCCATCTTCTGCAGGGAAGA No data
Right 1102633012 12:114298707-114298729 GGAAGATCTACCTCCCCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102633008 Original CRISPR TCTTCCCTGCAGAAGATGGA GGG (reversed) Intergenic
No off target data available for this crispr