ID: 1102635353

View in Genome Browser
Species Human (GRCh38)
Location 12:114318876-114318898
Sequence ACTCCCTTACTGGTGCTTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102635348_1102635353 -1 Left 1102635348 12:114318854-114318876 CCTTTCAAATTTCTCCACTCCCA No data
Right 1102635353 12:114318876-114318898 ACTCCCTTACTGGTGCTTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102635353 Original CRISPR ACTCCCTTACTGGTGCTTAC TGG Intergenic
No off target data available for this crispr