ID: 1102636045

View in Genome Browser
Species Human (GRCh38)
Location 12:114324997-114325019
Sequence TGGTTCTCCTAAGGAAAAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102636042_1102636045 6 Left 1102636042 12:114324968-114324990 CCTAAATCACAATGATAGCAGAG No data
Right 1102636045 12:114324997-114325019 TGGTTCTCCTAAGGAAAAACTGG No data
1102636041_1102636045 9 Left 1102636041 12:114324965-114324987 CCACCTAAATCACAATGATAGCA No data
Right 1102636045 12:114324997-114325019 TGGTTCTCCTAAGGAAAAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102636045 Original CRISPR TGGTTCTCCTAAGGAAAAAC TGG Intergenic
No off target data available for this crispr