ID: 1102639315

View in Genome Browser
Species Human (GRCh38)
Location 12:114352558-114352580
Sequence GGATGCACATAATTTCCTAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 122}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102639309_1102639315 27 Left 1102639309 12:114352508-114352530 CCATTGGGCACTCTGTCTTTGTA 0: 1
1: 0
2: 0
3: 25
4: 266
Right 1102639315 12:114352558-114352580 GGATGCACATAATTTCCTAAGGG 0: 1
1: 0
2: 0
3: 12
4: 122
1102639311_1102639315 -3 Left 1102639311 12:114352538-114352560 CCACCACTGCAATCCACTGAGGA 0: 1
1: 0
2: 1
3: 11
4: 196
Right 1102639315 12:114352558-114352580 GGATGCACATAATTTCCTAAGGG 0: 1
1: 0
2: 0
3: 12
4: 122
1102639312_1102639315 -6 Left 1102639312 12:114352541-114352563 CCACTGCAATCCACTGAGGATGC 0: 1
1: 0
2: 1
3: 20
4: 205
Right 1102639315 12:114352558-114352580 GGATGCACATAATTTCCTAAGGG 0: 1
1: 0
2: 0
3: 12
4: 122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102639315 Original CRISPR GGATGCACATAATTTCCTAA GGG Intergenic
907044332 1:51290610-51290632 AGATGTACATCATTTCCTGAAGG + Exonic
909186816 1:72497615-72497637 GGAAGTACACAATTTTCTAAAGG + Intergenic
909511570 1:76459053-76459075 GGAGGCACATAAATCCCAAAAGG - Intronic
912204215 1:107492821-107492843 GGAAGCACACTATTTCCGAATGG + Intergenic
913008125 1:114655263-114655285 TGATGCATATAATTTTCTAATGG - Intronic
914374356 1:147060715-147060737 CAATTCATATAATTTCCTAAAGG + Intergenic
917112545 1:171564138-171564160 GGATGGAAAGAATTCCCTAATGG + Intronic
918363057 1:183778829-183778851 AGATGCAGACAATTCCCTAAAGG - Intronic
919483103 1:198113434-198113456 AAATGCACATAATTTCTGAAGGG - Intergenic
920320185 1:205115006-205115028 GTATCCAAATTATTTCCTAAAGG + Intronic
923296430 1:232599096-232599118 GGATGCTCATTATTTGCTAAGGG - Intergenic
924870628 1:248040218-248040240 GGATCAACATTATTTCATAAAGG + Intronic
1063926254 10:10980644-10980666 GGACTCACATGATCTCCTAACGG + Intergenic
1063941785 10:11137377-11137399 GGATGCATATAAATTCCAGAGGG + Intronic
1064256750 10:13748891-13748913 GGATGCATAAAACTGCCTAATGG - Intronic
1067820097 10:49520840-49520862 GGAGGCACATTATTTCCTCAGGG - Intronic
1069186897 10:65434862-65434884 TGATGGACATAATGTCATAAAGG - Intergenic
1070941676 10:80353918-80353940 GGTTTCACATAGTTTCCAAAAGG - Intronic
1071816473 10:89237376-89237398 GGCTGCATATAAATTCCTAGAGG + Intronic
1072919083 10:99560310-99560332 GTAAGCACATAATTACATAATGG - Intergenic
1076508909 10:130998509-130998531 GGCTCCACATCATGTCCTAAAGG + Intergenic
1083010835 11:59397354-59397376 GAAAGAACATAAATTCCTAAAGG - Intergenic
1083342162 11:61965756-61965778 CAATGCCCATAATATCCTAAAGG - Intronic
1085218036 11:74849425-74849447 GGTTCCACATATTTTCCAAAAGG - Intronic
1085727034 11:78963006-78963028 ACATGAACAAAATTTCCTAAGGG - Intronic
1086890936 11:92257466-92257488 GGTCGGACATAATTACCTAATGG + Intergenic
1089020851 11:115213052-115213074 GGATGCACATAACAGACTAATGG + Intronic
1090173860 11:124630246-124630268 GGACACACATACTTTCCTATAGG - Intronic
1091081058 11:132668459-132668481 GGATGAACGTATTTTCCTCATGG + Intronic
1093228827 12:16517801-16517823 GGATTCTCATAATTTCTTATTGG + Intronic
1098101567 12:67023325-67023347 GGAAGCACATACTTTCCATAGGG + Intergenic
1100269369 12:93009516-93009538 GAATGCACATATATTCCAAAGGG + Intergenic
1101566819 12:105913901-105913923 GGAGGCACACAAATTCCTATTGG - Intergenic
1101984961 12:109438750-109438772 GGATGGACCTGAATTCCTAATGG - Intronic
1102639315 12:114352558-114352580 GGATGCACATAATTTCCTAAGGG + Intergenic
1104012402 12:124940952-124940974 GGTTGCATAGTATTTCCTAACGG + Intergenic
1108764651 13:53612003-53612025 TGATGCACCTACTTTCCTTAAGG - Intergenic
1113328648 13:109308114-109308136 GGATGCACTTGATTTATTAAGGG + Intergenic
1118639075 14:67775625-67775647 GCATGCACATAATAACATAAAGG - Intronic
1120033924 14:79674065-79674087 GGGTACACATAAATGCCTAATGG + Intronic
1124170835 15:27371375-27371397 CGATGCATATAAATTCATAAAGG + Intronic
1126465390 15:48956808-48956830 GGATAAACATTATTTCCTCAAGG + Intronic
1132211941 15:100030322-100030344 TGAAGTACATAATTTCCAAAAGG - Intronic
1135864685 16:26090496-26090518 GGGTGCACAAAATTTCCCATGGG + Intronic
1138570310 16:57867176-57867198 GGATGTACAGAATTTACAAATGG - Intergenic
1148399350 17:47340974-47340996 GGAAGCACATAATGTCCAATTGG - Intronic
1157135297 18:45048474-45048496 GGATACATATCATTTTCTAAAGG - Intronic
1157720389 18:49918873-49918895 GGATGGACAAAATTTCTAAAGGG + Intronic
1157923526 18:51738393-51738415 TGATGCACAGAATTTTTTAAAGG - Intergenic
1159209570 18:65299498-65299520 GGATTTAAATAATTTACTAAGGG - Intergenic
1163213356 19:15858083-15858105 GGATACACTAAATTTGCTAATGG - Intergenic
925531300 2:4865439-4865461 GGATGCGCATACTTTCCAAAAGG - Intergenic
926956057 2:18301621-18301643 GTAAGAACATAATTCCCTAATGG - Intronic
928052979 2:28020352-28020374 ACATGCACATACTTTCATAATGG - Intronic
928794609 2:35001660-35001682 TCATACACATAATTTCCTATGGG - Intergenic
929241460 2:39657912-39657934 GGATTCACATAATTTTTAAAGGG + Intergenic
932724033 2:74162110-74162132 AGATGCAGATAATAGCCTAATGG + Intronic
933721124 2:85398374-85398396 GAATCCACCTAATTTCCAAATGG - Intronic
936723126 2:115278148-115278170 GGAAACACATTATTTCCTCATGG - Intronic
940801220 2:158135371-158135393 GTATGGCCATATTTTCCTAATGG - Exonic
941613458 2:167690850-167690872 GCATGCAAATAATTTCCAAAGGG - Intergenic
942522629 2:176820110-176820132 GGATGCACGCAAGTTCCTCAAGG - Intergenic
946581387 2:221131696-221131718 GGATGCCCAATATTGCCTAATGG + Intergenic
946608599 2:221433648-221433670 GGATGTGCATAATTTACCAAGGG + Intronic
948344215 2:237281675-237281697 AGATGCAGATAATTTCCTTTAGG - Intergenic
1184579851 22:45408860-45408882 GGATGCACTTAGTTTTGTAATGG - Exonic
949295798 3:2520976-2520998 GAATGCACGTACTTTCGTAAGGG - Intronic
949783432 3:7715116-7715138 TGATACAGATAATTTCCTATTGG - Intronic
949977461 3:9474153-9474175 TCAGGCACATGATTTCCTAAAGG + Intronic
951291144 3:20873537-20873559 GGAAGCACAAATTTTGCTAATGG + Intergenic
951491652 3:23276192-23276214 GGATGTACCTAAGTTACTAAAGG - Intronic
953068874 3:39500164-39500186 GAATGCACATAATGTGCTAATGG - Intronic
954990478 3:54836692-54836714 GGATGCACTTATTTTCCCCAAGG - Intronic
955534453 3:59908317-59908339 GGAGGCACCTAATTTCCTGCAGG + Intronic
955709697 3:61765450-61765472 AGATGAATATTATTTCCTAACGG - Intronic
957684752 3:83487513-83487535 TTATGCACATAGTTTCCCAAGGG - Intergenic
959151657 3:102615591-102615613 GGATACATATAATTTTCTGAAGG - Intergenic
959343516 3:105162116-105162138 GGATAAACTTAATTTTCTAATGG - Intergenic
959745029 3:109766293-109766315 GGATGCCCATTGTTTTCTAAGGG + Intergenic
961310110 3:125991363-125991385 GGGTTCAAATAACTTCCTAACGG + Intergenic
963586147 3:147191893-147191915 TCATGCATATAATTTCCCAATGG + Intergenic
963985148 3:151584570-151584592 GGATGCACATGATTTATCAAAGG + Intergenic
964198372 3:154089867-154089889 GGGTGCACACAACTACCTAATGG + Intergenic
964975055 3:162607892-162607914 TGATGAAAATAATTTCCTATAGG + Intergenic
966006291 3:175017366-175017388 GGATGGAGATAATTTGCTGAAGG + Intronic
971268578 4:25115881-25115903 GGATGCAAATAAGATCCTAAGGG - Intergenic
972422600 4:38903533-38903555 GGAGGCACATTATTTCCTTTTGG + Intronic
975336389 4:73181553-73181575 GTATGCCCATAATTTAATAAAGG - Intronic
975498835 4:75062699-75062721 GGAAGCACACAATTTCCCTAAGG + Intergenic
976177406 4:82368886-82368908 GGATTCACAGAATTCCCAAATGG + Intronic
977054231 4:92169494-92169516 GGTTGCATATATTTTCCTAGTGG - Intergenic
978543175 4:109841086-109841108 TGATGCAGATAATTTTGTAAAGG + Intronic
980267395 4:130535194-130535216 GTATGCACATTATATTCTAATGG + Intergenic
980317987 4:131230563-131230585 GTATGAACATTTTTTCCTAATGG - Intergenic
981297466 4:143148449-143148471 TGATTCACTGAATTTCCTAACGG + Intergenic
982084845 4:151823997-151824019 AGATGCATAGAATTTCCTATGGG - Intergenic
984215423 4:176907596-176907618 GGCAGCACATTATTTCTTAAAGG + Intergenic
986092495 5:4524011-4524033 GGATGAAAATAGATTCCTAAAGG + Intergenic
986574170 5:9195633-9195655 AAATGCACATAATTTGCTCAAGG + Intronic
995432422 5:112095922-112095944 GGAAGCAAATAATGTGCTAAAGG - Intergenic
997784578 5:136697769-136697791 ATATGCACATAATTTACTATGGG - Intergenic
998707431 5:144779321-144779343 GGAAGCACATATTTTTCCAAGGG - Intergenic
1001332897 5:170774778-170774800 GGATGCAAATAATTTCTGTAGGG + Intronic
1002356571 5:178634266-178634288 GCATGCTCACAATTTCCTCATGG - Intergenic
1003117126 6:3290393-3290415 AGATGCATATGATGTCCTAAGGG - Intronic
1003784307 6:9467123-9467145 GGATGCCCATGAATTCCTACTGG + Intergenic
1004882830 6:20025587-20025609 GGATGAACATATTTCCCAAAAGG + Intergenic
1010165458 6:72910034-72910056 GGATGCATATATTTTGATAAAGG - Intronic
1010478399 6:76318389-76318411 AAATGCACATTATTTGCTAAAGG + Intergenic
1011864533 6:91807743-91807765 TGTTGCAAATAAGTTCCTAATGG + Intergenic
1014987521 6:128029906-128029928 GGATGCACATGATTTATTAAGGG + Intronic
1015639494 6:135315865-135315887 GGATGCAGATAAGTTAATAAAGG - Intronic
1015788280 6:136940781-136940803 GGAGGCACATAATTTGGGAATGG + Intergenic
1016675816 6:146766498-146766520 GGAAACACATAACTTCCTGAGGG + Intronic
1017189243 6:151634291-151634313 AGGTGCACATCAATTCCTAATGG - Intergenic
1021009584 7:15444828-15444850 ATATGCATATAATTTCCAAAAGG - Intronic
1021401134 7:20210561-20210583 GCATGCACATTATTTCCTGAAGG - Intronic
1028525919 7:91786668-91786690 GGATGTAAATAATGTTCTAAAGG - Intronic
1029168013 7:98609283-98609305 AGATGAACATATTTTCCTGATGG + Intergenic
1030776532 7:113539911-113539933 GGATGTATATAATTTCACAATGG - Intergenic
1033070069 7:138193972-138193994 AGATGCACATAATTTTCTCAGGG - Intergenic
1038030670 8:23636159-23636181 GCATGCACAAAATTTACTAAAGG - Intergenic
1044332804 8:90941330-90941352 GGATGCCTGCAATTTCCTAATGG - Intronic
1044395008 8:91701192-91701214 AGAAGCACATAATCACCTAAAGG - Intergenic
1044819769 8:96147852-96147874 AGATGGAAATGATTTCCTAAGGG - Intronic
1045242613 8:100415796-100415818 TGATGGACATGATTTCCTACAGG + Intergenic
1049067796 8:140332180-140332202 GGTTGAACCTAATGTCCTAAAGG + Intronic
1051117863 9:13717724-13717746 GAATGCACATCATTTTATAAAGG - Intergenic
1053101004 9:35372383-35372405 AGAGGCACATGGTTTCCTAAAGG - Intronic
1187104475 X:16226580-16226602 GGATGAACATATTTTTTTAAAGG + Intergenic
1188729824 X:33631891-33631913 TGTTGTCCATAATTTCCTAATGG - Intergenic
1189429167 X:40932030-40932052 GGATGAACAGAATTCCCTAAAGG + Intergenic
1189854877 X:45214266-45214288 GGATTCACCTTATTTCCTAGGGG - Intergenic
1192843313 X:74880095-74880117 AGATGCATTTAAGTTCCTAAAGG - Intronic
1199534822 X:148890654-148890676 GGAGACACATAATTTCCTGGAGG - Intronic