ID: 1102639330

View in Genome Browser
Species Human (GRCh38)
Location 12:114352719-114352741
Sequence GTGCATTGTGTGCCTTGCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 141}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102639325_1102639330 25 Left 1102639325 12:114352671-114352693 CCAGTCTAAAGCAAGCACCCACC 0: 1
1: 0
2: 4
3: 10
4: 146
Right 1102639330 12:114352719-114352741 GTGCATTGTGTGCCTTGCCATGG 0: 1
1: 0
2: 1
3: 10
4: 141
1102639327_1102639330 8 Left 1102639327 12:114352688-114352710 CCCACCAAATACATTATAGGACT 0: 1
1: 0
2: 1
3: 6
4: 152
Right 1102639330 12:114352719-114352741 GTGCATTGTGTGCCTTGCCATGG 0: 1
1: 0
2: 1
3: 10
4: 141
1102639328_1102639330 7 Left 1102639328 12:114352689-114352711 CCACCAAATACATTATAGGACTG 0: 1
1: 0
2: 0
3: 12
4: 103
Right 1102639330 12:114352719-114352741 GTGCATTGTGTGCCTTGCCATGG 0: 1
1: 0
2: 1
3: 10
4: 141
1102639329_1102639330 4 Left 1102639329 12:114352692-114352714 CCAAATACATTATAGGACTGTAA 0: 1
1: 0
2: 2
3: 14
4: 148
Right 1102639330 12:114352719-114352741 GTGCATTGTGTGCCTTGCCATGG 0: 1
1: 0
2: 1
3: 10
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102639330 Original CRISPR GTGCATTGTGTGCCTTGCCA TGG Intergenic
900609240 1:3537488-3537510 GTGCTCTGTGTGCCAGGCCAGGG + Intronic
903790534 1:25889920-25889942 GTGCAGTGTGTTCCTGGCAAAGG - Intronic
904239341 1:29134046-29134068 GTGCATTCGGTGCCTTGCAATGG - Intergenic
904710992 1:32430036-32430058 GTGAATTCTGTGCCTTTTCAAGG + Intergenic
905727720 1:40268462-40268484 GTGCATTGACTGGTTTGCCATGG + Exonic
905882361 1:41472758-41472780 CTGAATTGTGTGCCTTGAAAGGG + Intergenic
906584744 1:46966276-46966298 TTGGATTTTCTGCCTTGCCAAGG + Intergenic
906642653 1:47450609-47450631 GTGCAGGGTGTGCCCAGCCACGG - Intergenic
907719409 1:56957795-56957817 GTGCAATGAGTGCCATGACAGGG + Intronic
908117247 1:60952405-60952427 TTGCATTGTGTTCCCTGCTATGG + Intronic
910565058 1:88634419-88634441 GAGTATTCTGTGCCTTGGCAAGG + Intergenic
910674821 1:89806180-89806202 GTGCATCGTGTGTCATGCCCTGG - Intronic
911258077 1:95655315-95655337 GGGCAGTGTGTACCTTGCTAAGG - Intergenic
911464312 1:98233039-98233061 ATGGATTTTTTGCCTTGCCAGGG - Intergenic
912724459 1:112046282-112046304 GTGCAGTGAGTGCCCAGCCAGGG - Intergenic
913505967 1:119516462-119516484 TTGCATTTTGTGCAGTGCCAGGG - Intergenic
916428222 1:164702136-164702158 GAGCACAGTGTGCCTTGCCCTGG + Intronic
917041424 1:170810014-170810036 TTGCCTTCTGTGCCTTTCCATGG + Intergenic
917855920 1:179099611-179099633 GGGCACTGTGTGCATTGCTAAGG - Exonic
919882092 1:201907525-201907547 CTACATTGTGTGCTTTTCCATGG + Intronic
920299571 1:204980320-204980342 GTCCAATTTGTGCCTTTCCAGGG - Intronic
920647549 1:207814535-207814557 GTGCAGTGTGTCCCTGGGCATGG - Intergenic
924674894 1:246165895-246165917 CAGCATTGTCTGCATTGCCAGGG - Intronic
1063070763 10:2660733-2660755 GTGCATTCTCTGGCTGGCCAGGG - Intergenic
1064276146 10:13906884-13906906 GTGCACTGTTTGCCTTCCCATGG + Intronic
1065060841 10:21899270-21899292 ATGAATTGCCTGCCTTGCCAGGG - Intronic
1070181529 10:74018639-74018661 GTGGATTGTGTCCCTTGTGAAGG + Intronic
1070889130 10:79929095-79929117 GTGTATTATGTGACTTGCCCAGG - Intergenic
1078201307 11:9186428-9186450 TTGCATTGTGTGCCTTTCGTGGG - Intronic
1081191736 11:40112388-40112410 GTGGATTGTGTTCCTAACCAAGG + Intergenic
1081857343 11:46312221-46312243 GAGCATTGTGTGCCTTGCCCAGG + Intronic
1083189084 11:61036537-61036559 GTGCAGTGTGGTCTTTGCCAGGG - Intergenic
1084512821 11:69616703-69616725 GGGCTTTGTGTGTGTTGCCAGGG - Intergenic
1090384101 11:126346643-126346665 GTGGATTTTGTGCCTTGCTTGGG + Intergenic
1090650730 11:128803673-128803695 CTGTATTGTGTGCATGGCCAGGG - Intronic
1098214004 12:68196364-68196386 CTGCATAATGTGCCTTTCCAGGG + Intergenic
1100311786 12:93402419-93402441 GTGCATTGTGTGCTTACCCTGGG + Exonic
1100542918 12:95574884-95574906 GAGCACTGTGTGCCATGGCATGG + Intergenic
1101427357 12:104599048-104599070 GTGCAGTGTGATCCTTCCCACGG - Intronic
1102639330 12:114352719-114352741 GTGCATTGTGTGCCTTGCCATGG + Intergenic
1102867702 12:116387090-116387112 CTGCATTGGGAGCCTGGCCAAGG - Intergenic
1103881185 12:124167104-124167126 GGGCTTTGTGTGCCTTCACATGG - Intronic
1104690018 12:130818614-130818636 GTGCATTCTGTGCTTTTCCGCGG - Intronic
1108317449 13:49250664-49250686 AAGCATTGTATGCCTTGCAAAGG + Intronic
1113616042 13:111681294-111681316 GTGCCTCGTGTGCTCTGCCATGG + Intergenic
1113621510 13:111766187-111766209 GTGCCTCGTGTGCTCTGCCATGG + Intergenic
1113719095 13:112539441-112539463 GTATATTGTGTTCTTTGCCATGG - Intronic
1116507021 14:45696207-45696229 GAGCCTTGTCTGCCTTGCAATGG - Intergenic
1117619135 14:57566360-57566382 GTGAATTATGTTCCTTGCCTGGG - Intronic
1118350178 14:64968026-64968048 GGGCATTGAGAGCCTGGCCAAGG - Intronic
1118412239 14:65493155-65493177 CTGCATTGTATACCTTTCCAGGG + Intronic
1118815796 14:69313093-69313115 GTGCACTGGGTGCTATGCCAAGG - Intronic
1118924273 14:70177721-70177743 AGGCCTTGTGTGCCTGGCCAAGG + Intronic
1119805167 14:77477671-77477693 CTGCATCATGTGCCTGGCCATGG - Intronic
1119887871 14:78158867-78158889 GTACATTGTGTGCCTTGAGGGGG + Intergenic
1125067345 15:35504203-35504225 GAGCCTTGTGTGCCTTGCTGAGG - Intronic
1130909975 15:88264253-88264275 GTGCATAATGTGCCTAGCCCAGG + Intergenic
1131472402 15:92708561-92708583 GTGTCTTGTAAGCCTTGCCAGGG - Intronic
1132859454 16:2062850-2062872 GTGCCCTGTGTGCCTGGCCGCGG + Intronic
1135181939 16:20282522-20282544 GGGCCTTGTGTGCCTGGCCAAGG + Intergenic
1136265783 16:29117236-29117258 GTGCTTTGTGGACCTCGCCAGGG + Intergenic
1140969057 16:79995363-79995385 GTTCATTCTAGGCCTTGCCAAGG - Intergenic
1142054594 16:87985143-87985165 GTGCTTTGTGGGCCTCGCCAGGG + Intronic
1147041909 17:37725961-37725983 GTGGATTCTGTGCCCTGCCCAGG - Intronic
1152718275 17:81910356-81910378 GTGCACTGTGTGGGCTGCCAGGG - Intronic
1153859347 18:9185203-9185225 TAGCCTTGTGTGCCTTGCAAAGG + Intronic
1155401552 18:25445498-25445520 TTGCTTTGTGTGCCATGCTAAGG + Intergenic
1155807661 18:30192395-30192417 CTGGATTGTGTGCCATGGCATGG + Intergenic
1161801844 19:6420645-6420667 GGGCATTGTGGGCCTTGGCCTGG + Intronic
1163287985 19:16360828-16360850 GTGCTTTCTGTGCATTGACATGG + Intronic
1163885556 19:19961858-19961880 GTGCATTGTGTCCCTGGGTACGG - Intergenic
1165078882 19:33296567-33296589 GTGCACTGTGGGCCTTGCAAGGG + Intergenic
1166283357 19:41809467-41809489 GTCCTTTGTGTCTCTTGCCAAGG + Intronic
1166767338 19:45259423-45259445 GTCCAATGTGTGCGTTGCTAAGG + Intronic
1167660364 19:50792559-50792581 GTACAGTGAGGGCCTTGCCAGGG + Intronic
925577665 2:5377229-5377251 CTGCACTGTGTGCCTGGCCTGGG + Intergenic
930866513 2:56127167-56127189 CTGCATTGTGATCCATGCCAGGG + Intergenic
931856268 2:66304743-66304765 GTGCATTTTGTCCAGTGCCATGG - Intergenic
934249228 2:90333988-90334010 GTGCATTGTGTGCTTTAAAATGG + Intergenic
938685623 2:133734961-133734983 GAGCACTGTGTGCCCTTCCAAGG + Intergenic
940498099 2:154459265-154459287 GTGCATTGTATTCCATGCAAGGG + Intergenic
941713231 2:168736805-168736827 GTGCACTGCCTGCCATGCCAGGG - Intronic
942412826 2:175729428-175729450 GGGAATTGTGTGCCAGGCCACGG - Intergenic
944209275 2:197189512-197189534 GTGAAATGTGGTCCTTGCCACGG - Intronic
947047913 2:226009034-226009056 GGGCCTTGTGTGCCATGCCAGGG + Intergenic
1172169210 20:32918710-32918732 GAGCATTGTGGGCCTGGGCAGGG + Intronic
1172842223 20:37908860-37908882 GTGTGTTGAGTGCCATGCCAGGG + Intronic
1176014119 20:62920104-62920126 GTGCATTGTGGTCCTCACCAGGG - Intronic
1180876958 22:19179017-19179039 GTGCACTGTGTGCCGCGCCGCGG + Intergenic
1181178530 22:21051702-21051724 GGGCCTTGTGTGCCAAGCCAAGG - Intronic
1181483258 22:23214570-23214592 GTGCTTCGTGTGCCCTCCCAGGG + Intronic
1183782254 22:40006461-40006483 GTGTAGTGTGTGCCTTCCCTAGG - Intronic
1183987813 22:41578934-41578956 GTGGACTGTGTGCCCAGCCAGGG - Intronic
1185114703 22:48925653-48925675 GTGCATAGTGAGCGTTGCCCTGG + Intergenic
949923293 3:9021265-9021287 GTGGAGGGGGTGCCTTGCCAAGG - Intronic
950683437 3:14601180-14601202 CTGGACTGTGTGCTTTGCCAGGG + Intergenic
955852267 3:63233407-63233429 GGGCCTTGTGTGCCATGCTAAGG - Intronic
958024059 3:88029139-88029161 GTTCATTGTGGGCATTGGCATGG + Intergenic
960543777 3:118889080-118889102 GGGCCTTGTGTGCAATGCCAAGG + Intergenic
962398030 3:135034680-135034702 GTGCCTGGGGTGCCCTGCCAAGG + Intronic
964627037 3:158769660-158769682 GTACACTGTGTGCCTTACCGGGG - Intronic
965118451 3:164521106-164521128 GTGCCCTGTGTGCCTTTACATGG + Intergenic
965144938 3:164889520-164889542 GAGCATTGTGTAGATTGCCAAGG - Intergenic
969203632 4:5625154-5625176 GGGCATGGTGTGCCGTGCTAAGG - Intronic
970816718 4:20165108-20165130 GTGCACTGTGTGCTCTGGCATGG + Intergenic
972354772 4:38269971-38269993 GTGAATTCTGTGCCTATCCACGG + Intergenic
974722269 4:65755846-65755868 GTGCAATGTATACCTTGCCCTGG - Intergenic
977865667 4:102024266-102024288 GTGAATTGTTTTCCTTGTCAAGG - Intronic
979703134 4:123689963-123689985 CTGCATTGTGCCCCTTCCCAGGG - Intergenic
982261066 4:153494866-153494888 GTGCATTGGGTGACCTGCCGGGG + Intronic
983937546 4:173512678-173512700 ATGCATAGTGTCCCTTGCCAGGG - Intergenic
986702348 5:10423071-10423093 GGGTTTTGTGTGCCTTGCTAAGG + Intronic
989604626 5:43232244-43232266 ATGAAATGTGAGCCTTGCCATGG - Intronic
992380013 5:76227616-76227638 ATGCATTGTGTTCAGTGCCACGG - Intronic
993722096 5:91331765-91331787 GTGCAATGTGGTCCATGCCAAGG - Intergenic
995260535 5:110098790-110098812 GTGCCTTGTGTACCTAGCCTTGG + Intergenic
995615709 5:113960835-113960857 TTTCATTGTGTGGCTTGCCATGG + Intergenic
999710877 5:154317230-154317252 GTGGATGGTGTCCCATGCCAGGG + Intronic
1001671976 5:173481276-173481298 TTGCATTGTGTCCCTGGCCTGGG + Intergenic
1002103840 5:176870219-176870241 GTGCATCGTGGGCCTGGCCCTGG + Intronic
1002341535 5:178519378-178519400 GCACATTGTGTGCCTGGTCATGG - Intronic
1003182811 6:3806567-3806589 GTCCCCTGTGTGCCTTCCCAGGG - Intergenic
1008630237 6:53357529-53357551 GGGCATTGTTTGCCTTAGCAGGG - Intergenic
1013311677 6:108900484-108900506 GTGCACTGTGTGCCAGGCCCTGG - Intronic
1014555069 6:122836054-122836076 AGGCATTGTGAGCATTGCCAAGG + Intergenic
1018676147 6:166223908-166223930 GTGAATTGTGGGCTCTGCCAAGG - Intergenic
1025904866 7:65775739-65775761 GTTCATTGTCTGCATGGCCAGGG + Intergenic
1027621386 7:80490974-80490996 GTGTCTTGTGTGCCATGGCAAGG + Intronic
1029567817 7:101350612-101350634 GGGCTTGGTGTGGCTTGCCATGG + Intergenic
1031447283 7:121870988-121871010 GTGGCTTTTGTGCCTTCCCAGGG + Intergenic
1031581120 7:123476355-123476377 TTGCATTGGGTGCCTTTACATGG - Intronic
1032253569 7:130278911-130278933 GTCCATTGTAGGCCTGGCCAGGG - Intronic
1035023433 7:155811779-155811801 GTGGAATGTGTGGCTTTCCAGGG - Intronic
1036964928 8:13286578-13286600 TTGCATTCTGTGCCTTGAAAAGG - Intronic
1037036440 8:14174710-14174732 GAATATGGTGTGCCTTGCCAGGG + Intronic
1039289177 8:36075437-36075459 CTGCATTGGGTGCCTGGCCAAGG + Intergenic
1041903495 8:63007743-63007765 GTGCCTTCTGTGCCTTGGCCAGG - Intergenic
1042500741 8:69506155-69506177 GTGCATTGTGTTCCATTACATGG + Intronic
1045863176 8:106836062-106836084 GTGGAATGTGTGCCTGGCCTAGG + Intergenic
1047991776 8:130293869-130293891 GTGCACCATGTGCCTTGCAATGG + Intronic
1050331709 9:4552523-4552545 TGGCCTCGTGTGCCTTGCCAAGG + Intronic
1050587614 9:7129417-7129439 GTGAATTGTGTTTCTTACCAGGG + Intergenic
1053279508 9:36809104-36809126 GTGCAATGTTTGCTATGCCAAGG - Intergenic
1057845704 9:98520808-98520830 GTGAGTTCTGTCCCTTGCCAGGG - Intronic
1057949705 9:99359979-99360001 CTGCAGTGTGTGACTTGGCATGG + Intergenic
1060889295 9:127177945-127177967 GTCCATTCTGTCCCCTGCCAGGG - Intronic
1061239758 9:129362707-129362729 CTGCATTCTGTTCCTCGCCAAGG - Intergenic
1062010190 9:134263035-134263057 GGGCATTGTCTGCCATGACATGG + Intergenic
1190466426 X:50728657-50728679 GTACATTGTGTGCATGCCCAAGG + Intronic
1194246859 X:91524694-91524716 TTGCAATGTGTGAATTGCCATGG - Intergenic
1196054266 X:111338325-111338347 GTGGTTTGTGTTCCTTGCCACGG - Intronic
1196264806 X:113630237-113630259 CTGCATTTTGTCCCTTGACAGGG - Intergenic
1200565818 Y:4765966-4765988 TTGCAATGTGTGAATTGCCATGG - Intergenic