ID: 1102643076

View in Genome Browser
Species Human (GRCh38)
Location 12:114383561-114383583
Sequence TTTTACAAAGATCTCTTTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 462
Summary {0: 1, 1: 1, 2: 7, 3: 52, 4: 401}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102643073_1102643076 7 Left 1102643073 12:114383531-114383553 CCACTGCAAAGAGAACTTGCCTG 0: 1
1: 0
2: 4
3: 13
4: 233
Right 1102643076 12:114383561-114383583 TTTTACAAAGATCTCTTTGGTGG 0: 1
1: 1
2: 7
3: 52
4: 401

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102643076 Original CRISPR TTTTACAAAGATCTCTTTGG TGG Intronic
900783376 1:4632160-4632182 TCTTACAAAGACCTCTGTGATGG + Intergenic
901148149 1:7082124-7082146 TTTTAGAAACATCACTCTGGTGG - Intronic
903022718 1:20405229-20405251 TCTTACTGAGATCACTTTGGAGG - Intergenic
904545670 1:31269191-31269213 CTTTACACATCTCTCTTTGGGGG + Exonic
905203024 1:36326609-36326631 TTTTGGAAAGATCCCTGTGGTGG + Intronic
905466697 1:38159797-38159819 TTTTAAAAAGATCACCTTGGTGG + Intergenic
906344680 1:45007748-45007770 TTTTAGAAAGCTCTCCCTGGTGG - Intronic
906900158 1:49826852-49826874 TTTTACTAATATTTCTTTTGTGG - Intronic
908171233 1:61506716-61506738 TTTTATATAGATAGCTTTGGGGG - Intergenic
908344634 1:63219599-63219621 ATTTTCAAAGATTTTTTTGGGGG - Intergenic
908889549 1:68828826-68828848 TTTTACAAAGATAACTTTGGAGG + Intergenic
909093110 1:71252273-71252295 TTTTACATAGACCTCTTTGCTGG + Intergenic
909323607 1:74321289-74321311 TCTTACAAATATCTCTTTGGTGG + Intronic
910351587 1:86305004-86305026 TTTTAAAAAGAGTTGTTTGGGGG - Intergenic
910397482 1:86807029-86807051 TTTTACAGAGAGCTGATTGGGGG - Intergenic
911459479 1:98171599-98171621 TTCTCCCAAGATCTCTATGGAGG - Intergenic
911593548 1:99774928-99774950 TTTTACTAAAATGTTTTTGGTGG - Intergenic
912359135 1:109080256-109080278 TTTTAAAAAGATCACTTTTGCGG + Intergenic
912423818 1:109568212-109568234 TTTTAAAAAGATCTCTGAGCAGG - Intronic
914384922 1:147159266-147159288 TTTCACCAAGACCTGTTTGGGGG - Exonic
914425098 1:147568675-147568697 TTTTAGAAAGATCTGTAGGGAGG - Intronic
914439477 1:147691200-147691222 TTTGAAAAGGATTTCTTTGGAGG - Intergenic
914833374 1:151187406-151187428 TTTTACAAACATCAGTTAGGAGG - Intronic
914952555 1:152129572-152129594 TTTTACTAAAAACTGTTTGGTGG + Intergenic
915189990 1:154141849-154141871 TTTTACAAAAATTTGTGTGGAGG - Intronic
915842458 1:159225625-159225647 TCATACATAGATCACTTTGGAGG + Intergenic
918290018 1:183098492-183098514 TTGTACAAACATCTCTGTGGAGG - Intronic
918372639 1:183876503-183876525 TTTTCCAAAGTAATCTTTGGTGG - Intronic
918688754 1:187452977-187452999 TTTTACAAATATATCTTAGCAGG + Intergenic
918743367 1:188165858-188165880 TTTTAGAAACATCACTTAGGTGG - Intergenic
919166151 1:193896060-193896082 TTTTAGAAAGATTTCTCTGCCGG + Intergenic
919257702 1:195144754-195144776 ATTTAAAAATATCTCTTGGGAGG - Intergenic
919373865 1:196766997-196767019 TCTTACAAAGAGTTCATTGGAGG - Intergenic
919374433 1:196776254-196776276 TCTTACAAAGAGTTCATTGGAGG - Intronic
919383527 1:196889550-196889572 TCTTACAAAGAGTTCATTGGAGG - Intronic
920613054 1:207460836-207460858 ATTTACTGAGTTCTCTTTGGTGG + Intronic
921026883 1:211292787-211292809 ATTTACAAAGATGTCTTGGCCGG + Intronic
921246859 1:213252649-213252671 GATTCCAAAGTTCTCTTTGGGGG - Intronic
924062813 1:240193815-240193837 TTTTAGAAAGATAACTCTGGAGG - Intronic
1063678447 10:8162858-8162880 TTTTGCATAGACCCCTTTGGTGG - Intergenic
1064230571 10:13526926-13526948 TTTTACAAGCTTCTCTATGGAGG + Intronic
1064368550 10:14730209-14730231 TTTTAAAAATATCTCTGAGGTGG + Intronic
1064383355 10:14866193-14866215 TCTTCAAAAGATCTGTTTGGAGG - Intronic
1064532805 10:16327485-16327507 GTTTCCAATGAGCTCTTTGGAGG - Intergenic
1065446042 10:25800768-25800790 TTTTCCTAATATGTCTTTGGTGG - Intergenic
1065847105 10:29754299-29754321 TTTAGCCAAGATCTCTTTGAGGG + Intergenic
1067363549 10:45603810-45603832 TTATAAAAAGTTCACTTTGGAGG - Intergenic
1067857970 10:49813492-49813514 TGTTAGGAAGATATCTTTGGGGG - Intergenic
1068282751 10:54896955-54896977 TTTTAAAAAGAACTCTTTCAGGG + Intronic
1068711530 10:60140593-60140615 TTTTAAAAAGATTTTTTTGGGGG - Intronic
1069126932 10:64647215-64647237 CTTTACAAAGATCTTTATGGGGG - Intergenic
1070596572 10:77836912-77836934 TTTTAAAAAGAATTATTTGGGGG + Intronic
1071851144 10:89571791-89571813 TTTTTCAAAGATAATTTTGGAGG + Intergenic
1073226861 10:101928335-101928357 TATGAAAAAGATCTCTTTAGTGG - Intronic
1073463150 10:103678053-103678075 TTTTCTAAAAATCTCTTTGAAGG - Intronic
1074263628 10:111879075-111879097 TTTTAAAAGCATCTCTTTAGTGG - Intergenic
1074621039 10:115123278-115123300 CCTCACAAAGATCTCGTTGGGGG + Intronic
1074808249 10:117075880-117075902 TTTTAGAAAGATAACTTTAGAGG + Intronic
1075391959 10:122098582-122098604 TTTTACATAACTCTCTGTGGTGG - Intronic
1075432243 10:122396270-122396292 TTTTGAAAAAATCACTTTGGTGG + Intronic
1076462543 10:130656506-130656528 GTTTACAAATATCTCCCTGGTGG + Intergenic
1076465600 10:130679416-130679438 TTTTTAAAAGATCTCTCTGTTGG + Intergenic
1077097877 11:806877-806899 TTTTAAAAAGATCTCTTGGCCGG - Intronic
1079151982 11:17908117-17908139 TTTTAGAAAGATCACTGTGATGG - Intronic
1079287121 11:19145393-19145415 TTTAAGAAAGATCGCATTGGAGG - Intronic
1080007561 11:27425868-27425890 GTTTATAAATATCTCTTTGATGG + Intronic
1080566484 11:33514118-33514140 TGTTCCAGATATCTCTTTGGAGG + Intergenic
1080727578 11:34913765-34913787 TTTTACAAAGAGCTGATTGGTGG + Intronic
1080779249 11:35415840-35415862 TTTTAGAAATATCTTCTTGGAGG - Intronic
1080828857 11:35872636-35872658 ATTTATCAAGATCTCTTTGTAGG + Intergenic
1081046692 11:38282198-38282220 TTTGACAAAGATCTTTTAAGAGG - Intergenic
1081894646 11:46574734-46574756 TTTTTCAAAGTATTCTTTGGAGG - Intronic
1083597462 11:63925151-63925173 TTTTAGAAAGATCACCCTGGAGG - Intergenic
1085058771 11:73425444-73425466 TTTTACAGACAGCTCTTTAGAGG - Intronic
1085136935 11:74099479-74099501 TTTTACAAAGAGCACCTTTGTGG - Intronic
1085439509 11:76545829-76545851 TGTTACAAAGATAACTTTTGAGG + Exonic
1085843642 11:80041782-80041804 TTTAAAAAAGATTTTTTTGGGGG - Intergenic
1085868711 11:80325368-80325390 TTCTACAAAGCTGTCTTTTGTGG + Intergenic
1085915587 11:80883903-80883925 ATTTACAAAAATCTCTTAAGTGG + Intergenic
1086352872 11:85960696-85960718 CTTTGCAGAGCTCTCTTTGGAGG - Intronic
1086849201 11:91789139-91789161 TTTTAAAAATATCTCTATGGTGG - Intergenic
1086988628 11:93278216-93278238 TTTTACCAACCTCTCTATGGCGG - Intergenic
1088946587 11:114519405-114519427 TTTAATAAAGTTCTCTTTGGGGG + Intergenic
1089680925 11:120118481-120118503 TTTTAGAAAGATAGCTTTGGTGG - Intronic
1090747573 11:129719621-129719643 TTTTAAAGAGAGCTGTTTGGGGG + Intergenic
1091430502 12:429753-429775 TTTTAAAAGCAGCTCTTTGGTGG - Intronic
1091947000 12:4555446-4555468 TTTTAAAAACATCTTTCTGGTGG - Intronic
1093613080 12:21186643-21186665 TTTTACAATGATCTTTATGCTGG - Intronic
1093887227 12:24476028-24476050 TTTTACAATCAACTCCTTGGAGG + Intergenic
1094162278 12:27404363-27404385 TTTTACATTGATCTATTTGTGGG - Intronic
1094193756 12:27724237-27724259 TTATTTAAAGATGTCTTTGGTGG + Intronic
1094219614 12:27977814-27977836 GATTCCACAGATCTCTTTGGAGG - Intergenic
1095742268 12:45620519-45620541 TTTTAAAAAGATCTCTGCTGAGG - Intergenic
1097354992 12:58591179-58591201 TTTTGCAAAGATCTCACTGTGGG + Intronic
1097681152 12:62650458-62650480 TCAGCCAAAGATCTCTTTGGAGG - Intronic
1097992178 12:65847485-65847507 TTTTAAAATGAGCTCTTTGAGGG + Intronic
1098318071 12:69212915-69212937 TTTTAAAAAGAATACTTTGGTGG - Intergenic
1099656315 12:85496606-85496628 TTTTACACAGAAGTGTTTGGGGG + Intergenic
1099862929 12:88242249-88242271 TTCTACAAAGAGCCATTTGGTGG + Intergenic
1099866415 12:88287945-88287967 TTTTAGAAATATCTTTCTGGTGG - Intergenic
1100143209 12:91644154-91644176 TTTTAAAAAAAAGTCTTTGGGGG - Intergenic
1100274098 12:93055665-93055687 TCTTACAAAAATCTCTCTGCAGG + Intergenic
1100825043 12:98467199-98467221 TTTTACAAAGCTCTCTATATTGG - Intergenic
1100908693 12:99333048-99333070 TTTTAGAAACATCACTCTGGAGG + Intronic
1100951943 12:99860539-99860561 TTTTAGAAAGATCCCTCTGGAGG + Intronic
1101074863 12:101118434-101118456 TTTTAAAATGTTTTCTTTGGGGG - Intronic
1101255854 12:102975830-102975852 GTTTTAAAAGATCACTTTGGTGG - Intergenic
1102226923 12:111235351-111235373 TTCCAGAAAGATCTCTCTGGAGG + Intronic
1102601250 12:114032532-114032554 TTTTCCAAACATCTTTTTGGTGG + Intergenic
1102643076 12:114383561-114383583 TTTTACAAAGATCTCTTTGGTGG + Intronic
1102763449 12:115409957-115409979 TCTTACACAGATCTGTATGGTGG + Intergenic
1103254672 12:119530924-119530946 TTTCACCAGGATCTTTTTGGCGG - Exonic
1103849308 12:123921415-123921437 TTTTCCAAAGTTCACTTGGGTGG + Intronic
1104031145 12:125066252-125066274 TTTTACTAGGTTCTGTTTGGGGG - Intronic
1104081108 12:125431181-125431203 TTTTTGAAAGATCTGCTTGGAGG + Intronic
1104286548 12:127429862-127429884 TTTTACACTGAGCACTTTGGTGG - Intergenic
1104751427 12:131242365-131242387 TTTAACAAAGATATCTGTGCTGG - Intergenic
1107054711 13:36090549-36090571 TCTTAGAAAGAGCTCTCTGGAGG + Intronic
1107927877 13:45280955-45280977 TTTTACAAAGATGTCATTCTTGG + Intronic
1108112327 13:47088585-47088607 TTTCTCATAGATCTCTTAGGTGG + Intergenic
1108470028 13:50758413-50758435 TTTTACACTGCTCACTTTGGGGG - Intronic
1108488162 13:50949515-50949537 TGTGACTAAGATATCTTTGGGGG + Intronic
1109021534 13:57100876-57100898 TAGCACAAACATCTCTTTGGTGG - Intergenic
1109302648 13:60605033-60605055 CTTTAAAAGGATCTCTTGGGTGG + Intergenic
1110079174 13:71289445-71289467 TTTCACAGAGATGTCTTTGAAGG + Intergenic
1111956820 13:94768368-94768390 TTTTTCAAAACTCTCTGTGGGGG + Intergenic
1112426563 13:99307105-99307127 TTTGACAAAGATATTTCTGGTGG + Intronic
1113194981 13:107792426-107792448 TTTTATAAAGATCTGTTTGTGGG - Intronic
1113216835 13:108051330-108051352 TTTTACAATGATCTCTTTGCTGG + Intergenic
1114996263 14:28355999-28356021 TTTTAAAAAGAACTTTTTCGTGG - Intergenic
1115286963 14:31725114-31725136 TTTTAAAAGGATTACTTTGGTGG + Intronic
1115314020 14:32007519-32007541 TTTTTCAAAGCTTTCCTTGGGGG + Intronic
1115945391 14:38654081-38654103 TTTTAAAAGCATCACTTTGGTGG - Intergenic
1116914167 14:50506240-50506262 TTTTAAAAGGATCTCTTTGAAGG - Intronic
1117613300 14:57506163-57506185 TTTGAAGAAAATCTCTTTGGAGG + Intergenic
1117736314 14:58772326-58772348 TTTTACAAAGGCCTCTTTTATGG + Intergenic
1118624656 14:67646853-67646875 TTTAACAAATATGTATTTGGGGG - Intronic
1118641788 14:67799138-67799160 CTTTAAAAAGATATCTTTAGAGG + Intronic
1118673024 14:68151153-68151175 TTTTTGAAAGATATCTTTGTTGG + Intronic
1119919990 14:78437949-78437971 TTTTAGAAAGATCTTTCTGGTGG + Intronic
1120017341 14:79488822-79488844 TTTTAGAATGATCTCTTTGGGGG + Intronic
1120387629 14:83866131-83866153 TTTTACAGAGAACTGATTGGTGG - Intergenic
1122670746 14:103370143-103370165 TTTTACAAAGAACTGTTTCTTGG + Intergenic
1124185170 15:27518842-27518864 TTTTACAAAGTTCCTTTTGATGG + Intronic
1124550352 15:30675335-30675357 TGTTACAAAGATATGTTTTGTGG - Intronic
1125019273 15:34969061-34969083 TTTTAGATAGGTCTATTTGGAGG + Intronic
1125124953 15:36209190-36209212 TTTTCCAAATACCTCCTTGGAGG - Intergenic
1125189701 15:36976382-36976404 TTTTAAAAAAATCTCTTTATAGG - Intronic
1126264701 15:46740066-46740088 TTTAAAAAAGCCCTCTTTGGAGG + Intergenic
1126266274 15:46757073-46757095 TTTAAAAAAGCTCTCTTTGGAGG - Intergenic
1126351439 15:47748832-47748854 TTTTAGAAAGATCATTCTGGTGG + Intronic
1126634521 15:50767778-50767800 TTTTAGAAAGCTCTCTATGGTGG + Intergenic
1127808189 15:62540394-62540416 TTTTACAGAGCACTCTTTGAAGG - Intronic
1128813589 15:70588997-70589019 TTGTTCAAACCTCTCTTTGGAGG + Intergenic
1128950379 15:71873935-71873957 TTTCACAAAAATCTCAGTGGTGG + Intronic
1129068489 15:72931283-72931305 TTTTAAAAAAATCACTTTGTGGG - Intergenic
1129577925 15:76772407-76772429 TTTTACAACAATATATTTGGAGG + Intronic
1129991261 15:79965434-79965456 TTTTAAAAATATCGCTGTGGGGG + Intronic
1130436594 15:83905633-83905655 TTTTTGAAAGATCCCTCTGGTGG + Intronic
1132174012 15:99693649-99693671 TTTCTCAAAGATATTTTTGGTGG - Intronic
1132476140 16:138906-138928 TTTTACAAATAACACTTGGGCGG + Intergenic
1134328194 16:13226298-13226320 TCTTGAAAATATCTCTTTGGAGG + Intronic
1135636479 16:24080088-24080110 CTTTTGAAAGATCACTTTGGTGG + Intronic
1135711180 16:24718699-24718721 AGTTAGAAAGACCTCTTTGGTGG + Intergenic
1136996386 16:35193611-35193633 TTTTACCAGTTTCTCTTTGGTGG - Intergenic
1137542353 16:49373570-49373592 TTTTATTAAGATCTCTGTGGAGG + Intergenic
1138141086 16:54569042-54569064 ATTAATAAAGATGTCTTTGGGGG + Intergenic
1138177319 16:54912552-54912574 TTTTAAATATATCACTTTGGTGG - Intergenic
1139064353 16:63293463-63293485 GTTTAGAAAGATCTCCCTGGTGG - Intergenic
1139877638 16:70158877-70158899 CTTTACAAAGATGGCTTTGGAGG - Exonic
1141216045 16:82024751-82024773 TTTTCCACAGATCTTTGTGGGGG + Intergenic
1141918212 16:87115726-87115748 TATGACAAAGATCTCTTTCACGG - Intronic
1143283744 17:5773919-5773941 TTTTAGAAAGATGTCTCTGCTGG + Intronic
1143287684 17:5802376-5802398 TTTTAGAAAGATCCCTTGGGGGG - Intronic
1143374637 17:6459996-6460018 TTATAGAAAGATCCCATTGGTGG - Intronic
1143405388 17:6674190-6674212 TTTTACAGAGATGTTTCTGGTGG + Intergenic
1143825498 17:9603035-9603057 TGTTACATGGAGCTCTTTGGAGG - Intronic
1144245983 17:13365194-13365216 TTTTACCAAGACCTCATTGTTGG - Intergenic
1144292816 17:13842762-13842784 TTTTACATAGAGCTCAATGGAGG - Intergenic
1145289058 17:21528638-21528660 TTTTTCAAAGATTTCTTCCGCGG - Exonic
1147023759 17:37562203-37562225 TTTTACAAAGATCACATCAGCGG + Intronic
1148976516 17:51534906-51534928 TGTAACAAAGAGTTCTTTGGTGG - Intergenic
1149462032 17:56836605-56836627 TTTTAGAAAGATCATTTGGGTGG - Intronic
1149764139 17:59260727-59260749 AAATACAAAGAACTCTTTGGTGG + Intronic
1155205205 18:23552509-23552531 TTTTACAAAGATAGCTTGCGTGG + Intronic
1155789507 18:29947768-29947790 TTTTACAAAGGTCTTTATGCTGG + Intergenic
1156205356 18:34880238-34880260 TTTTGCAAATAAGTCTTTGGAGG - Intronic
1157497728 18:48168224-48168246 TTTTCCAAGGACCTCTTTGCAGG - Intronic
1159221352 18:65467795-65467817 TTTTATAAATCTCTTTTTGGAGG + Intergenic
1159881742 18:73864831-73864853 TTTTAGAAAAATTACTTTGGTGG - Intergenic
1160126144 18:76173918-76173940 CTTTACCCAGATTTCTTTGGAGG + Intergenic
1160813239 19:1022505-1022527 TTTTAAAAACATTTTTTTGGGGG - Intergenic
1162425731 19:10594273-10594295 TTTCAGAGAGATCTCTTTAGTGG - Intergenic
1164299296 19:23947065-23947087 TTTTATAAAAACCTCTTTGATGG + Intergenic
1165408925 19:35646564-35646586 TTTTAGGAAGATCTCATTGCAGG + Intergenic
1165603317 19:37077806-37077828 TTTTACACAGATCTCTATTGTGG - Intronic
1165667020 19:37640347-37640369 TTTTACATACATGTTTTTGGAGG - Intronic
1167881221 19:52459562-52459584 ATTTGCAAATATCTCTTTGAGGG + Intronic
925080469 2:1059599-1059621 TTTTATAAATTTCTCTTTTGTGG + Intronic
925883255 2:8370257-8370279 TTTTACATCCATCTGTTTGGGGG - Intergenic
926733216 2:16053067-16053089 TTTTGGAAAGATCACTTTGGTGG + Intergenic
926983242 2:18593846-18593868 TTTTAGAAAGATCTCTTTAGTGG - Intergenic
928361805 2:30669252-30669274 TTTTAAAAAGATATTTTTGCTGG + Intergenic
928520289 2:32081962-32081984 TTTTAAAAACATCTGTTTGAAGG - Intronic
929311654 2:40432781-40432803 TTTTAGAAGGATCTCTCTGCTGG + Intronic
929341829 2:40828728-40828750 TTTTACAAATATAACTTTGGGGG - Intergenic
930369157 2:50482106-50482128 CTTTAAAAAAATCTTTTTGGGGG - Intronic
931091092 2:58887258-58887280 TTTTACAAACACCTTTTTGAAGG + Intergenic
931234259 2:60400037-60400059 TTTTAAAAAGATCTCTCCTGGGG + Intergenic
931593027 2:63907220-63907242 TTATACAAAGATTTCTTGGCCGG + Intronic
932132136 2:69197283-69197305 TTTTACAAGGAGCACTGTGGTGG - Intronic
932300054 2:70660488-70660510 TTTTAGGAAAATCCCTTTGGTGG - Exonic
932830405 2:74984115-74984137 TTTTAAAAAGATGTCTGTGCTGG + Intergenic
933273663 2:80260876-80260898 TTTTACAATGATTGCTTTGGTGG - Intronic
933781685 2:85807017-85807039 TTTTGGAAAGATCACTTTGGTGG + Intergenic
934667708 2:96184578-96184600 TTAAAAAAAGATCACTTTGGAGG - Intergenic
935713001 2:105915932-105915954 TTTTCCAAAGATGATTTTGGGGG + Intergenic
936507974 2:113123234-113123256 TTTCCAAAAGATCTCTTTGGAGG + Intronic
938575088 2:132596169-132596191 TTTTAAAAAAATCTCAGTGGGGG - Intronic
938643505 2:133307896-133307918 TTTTTAAAACATCTTTTTGGGGG - Intronic
940121530 2:150273081-150273103 TTTTACAAAGAAGTATTAGGAGG - Intergenic
940755635 2:157678879-157678901 TTTTACATAATTCCCTTTGGTGG - Intergenic
941492761 2:166163079-166163101 ATTTAGAAAGGTCTCTCTGGGGG - Intergenic
942423284 2:175831008-175831030 TTTTTGAAAGATATCTTTGCTGG - Intergenic
942587237 2:177494773-177494795 TTTCAAAAGGATCACTTTGGTGG - Intronic
942634459 2:177987870-177987892 CTTTACAAAGACTTCTTTGAAGG - Intronic
943463011 2:188193213-188193235 TTTTTAAAAGGTGTCTTTGGTGG + Intergenic
944025666 2:195163738-195163760 CTTTATTAAGATCTCTTTGCTGG - Intergenic
944506027 2:200412075-200412097 TTTTACAAAGACCTCCTTGTAGG - Intronic
944534481 2:200695793-200695815 TTGTACAAAGGCCTCCTTGGGGG - Intergenic
945696071 2:213106221-213106243 TTTTAAAAAAATCTCTTTTGTGG + Intronic
945752309 2:213803521-213803543 TTTTAAAAAAATCTATCTGGAGG - Intronic
946500316 2:220240353-220240375 TTTTACAAAGATTGCTTTACAGG + Intergenic
946507702 2:220319037-220319059 TTTCACAAAAATATTTTTGGGGG + Intergenic
946683467 2:222242445-222242467 TTTAACAAAACCCTCTTTGGAGG + Intronic
947093937 2:226544912-226544934 TTTTTCAAGGATGGCTTTGGTGG - Intergenic
947502312 2:230680269-230680291 TTTGACAAAAATCTCTTGGTTGG - Intergenic
948162752 2:235838340-235838362 TTTTAGCAAAATCACTTTGGAGG - Intronic
1168814865 20:729299-729321 TTTTAAAAAGGTCATTTTGGAGG - Intergenic
1169458494 20:5774256-5774278 TTTTAGAAAGAACTCATTGTGGG + Intronic
1169540904 20:6598617-6598639 TTTTCAAAAGATTTCTTTGGGGG + Intergenic
1169565158 20:6845999-6846021 TGTTACAATGATCTATTTAGTGG + Intergenic
1169755939 20:9043349-9043371 TTTTCCAAAGATGACTTTGAGGG + Intergenic
1169906923 20:10613885-10613907 CTTTAAAAAGATATCTTTAGAGG - Intronic
1170083203 20:12499593-12499615 TTTTCCAAATATCACTTTAGGGG + Intergenic
1172150884 20:32789584-32789606 TTCAACAAAGATTTTTTTGGGGG + Intronic
1173051181 20:39563434-39563456 TTTGACACAGATTTCTTTGGGGG - Intergenic
1174464555 20:50707234-50707256 TTTTAGAAGGATCACTGTGGAGG + Intergenic
1177763482 21:25429993-25430015 TTTTAGAAATATCACTTTGGAGG - Intergenic
1178009049 21:28261361-28261383 CTTTACAAAGATTCCTTTGAAGG - Intergenic
1178130545 21:29567847-29567869 ATTTACAAAAATCGCTTTGAAGG + Intronic
1178193059 21:30308307-30308329 ATTTACTAAGATTTGTTTGGAGG + Intergenic
1178526005 21:33329865-33329887 TTTTACAAATACTTCTTTTGAGG + Intronic
1181841027 22:25661100-25661122 TTTTTGAAAAATCTCTTTGCAGG + Intronic
1182980039 22:34661127-34661149 TTTTAGAAATATATCTATGGTGG + Intergenic
1185213013 22:49582453-49582475 TTTTAAAACGAACTCTTTGTTGG - Intronic
949449693 3:4171991-4172013 TTTTAGAAAGATCACATTGAAGG + Intronic
949980050 3:9496775-9496797 TTTTAGAAAGAGCACTCTGGTGG - Intergenic
950121212 3:10483648-10483670 TTTGAAAAACATCTCCTTGGTGG - Intronic
951159439 3:19399245-19399267 TTTCAGAAGGATCTCTTTGCAGG + Intronic
952929688 3:38349401-38349423 TTTTGAAAATATCTCTCTGGGGG + Intronic
954826637 3:53379172-53379194 TTTCAAAATGATCTCTTTGAAGG - Intergenic
955072786 3:55585629-55585651 TGTTAGAGAGAGCTCTTTGGGGG + Intronic
955467548 3:59252720-59252742 TTCTAACAAGATATCTTTGGAGG + Intergenic
955930775 3:64054644-64054666 TTTTAGAAAGATCTTTCTGGTGG - Intergenic
956432441 3:69200675-69200697 TTTTAGAAAGGTCTCTTTTCTGG - Intronic
956552982 3:70482673-70482695 TTTTACAAAGAAATGTTTAGAGG + Intergenic
957204527 3:77178574-77178596 TTTTAAAATGTTCTCTTTGCTGG - Intronic
957587915 3:82156528-82156550 TTTTGCAACAGTCTCTTTGGAGG + Intergenic
957632807 3:82739784-82739806 CTTTGCAAAGATATCTTTTGTGG + Intergenic
958179707 3:90044415-90044437 TTTTCCAAAGGGGTCTTTGGGGG + Intergenic
958502486 3:94931555-94931577 TTTAACAAATATCTCCTTGTAGG + Intergenic
958645579 3:96868641-96868663 TTTTACAAATATGTCATGGGTGG + Intronic
959134361 3:102398534-102398556 TTTTAGGAAGATGTCTCTGGAGG - Intronic
960748230 3:120914131-120914153 TTTTTAAATGATCTTTTTGGGGG + Intronic
961341424 3:126224280-126224302 GTGTGCAAATATCTCTTTGGGGG - Intergenic
963196591 3:142538012-142538034 TTTTAAAAATATCTCTTTATTGG - Intronic
963733757 3:148995793-148995815 TTTTAGAAAGCTCTTTATGGTGG - Intronic
963849712 3:150198876-150198898 TTATCCAAATATTTCTTTGGGGG - Intergenic
964388704 3:156176097-156176119 GTTTACACACCTCTCTTTGGGGG + Intronic
964541968 3:157789665-157789687 TTTTAGAAAGATGACCTTGGCGG - Intergenic
964936893 3:162100508-162100530 TTTTAAAAATATGTCTTTTGGGG + Intergenic
966171202 3:177083012-177083034 ATTTTAAAATATCTCTTTGGAGG - Intronic
966566256 3:181384806-181384828 TTTTAGAAAGATCACTTAAGCGG - Intergenic
966605946 3:181821881-181821903 TTTTAGAAAGATCTCTCTGCCGG + Intergenic
968034350 3:195533646-195533668 TTTTACAATGGTCTTTATGGTGG - Intronic
971134330 4:23850954-23850976 TATTTTCAAGATCTCTTTGGGGG + Intronic
971391848 4:26193421-26193443 TTTTACAAAGTTGACTTTGGTGG + Intronic
971798886 4:31262523-31262545 TTTTAGAAAGACCACTTTTGGGG + Intergenic
974193324 4:58536383-58536405 TTTTAAAAATATGTTTTTGGGGG - Intergenic
974368416 4:60983329-60983351 TTTTAAAAAGATATTTTTGCTGG + Intergenic
974549652 4:63354767-63354789 TATGACATAGATGTCTTTGGTGG + Intergenic
975074056 4:70182537-70182559 TTTTACAAAGCACTCTTTCTAGG + Intergenic
975357485 4:73424988-73425010 TTTTACAAAGATCTGAGTGCTGG + Intergenic
975488265 4:74959271-74959293 TTTTACAAATATCTCTCAGAGGG + Intronic
976774105 4:88688355-88688377 TTTTAGAAAGATTACTTTGGGGG + Intronic
976965916 4:91040877-91040899 TTTTAAAAAGCTTTATTTGGAGG + Intronic
977230754 4:94449691-94449713 TTTTCAAAAGATGGCTTTGGGGG - Intergenic
977282108 4:95053254-95053276 TTTTAAAAAGCTCCCTTTGCAGG + Intronic
978963860 4:114717870-114717892 TTTTAAAAAGGTGTGTTTGGGGG - Intergenic
978992213 4:115098356-115098378 TTTTAGAAAGTTATCTTTTGAGG + Intronic
980063807 4:128159889-128159911 TTTTACAAAAACTTCTTTTGGGG - Intronic
980066842 4:128198736-128198758 TTTTAGGAAGATAACTTTGGTGG + Intronic
980230705 4:130042815-130042837 TTTTTAAAAGCTCTCTATGGAGG - Intergenic
980690181 4:136285854-136285876 TTTTACAAATATTTCTTTTAAGG - Intergenic
980729458 4:136808296-136808318 TTTTACAAAAATCTGTTGAGTGG - Intergenic
981218318 4:142198957-142198979 TTACACAAAGATCTCTATGTAGG - Intronic
981713317 4:147730495-147730517 TTTTACAAATAACTTTTAGGCGG - Intergenic
982030990 4:151300722-151300744 TTTTATAAAAATTGCTTTGGTGG + Intronic
982149866 4:152441751-152441773 TTTTAAAAAGCTCTCTTTGGAGG + Intronic
982490446 4:156023165-156023187 GTTCACAAAGCTATCTTTGGTGG + Intergenic
983032147 4:162816021-162816043 TTTTAAAAAGATTACTTTGATGG + Intergenic
983563678 4:169127093-169127115 TTTTTTAAAAATCTCTTTGTAGG - Intronic
984587381 4:181579348-181579370 TTTTTAAAAGATCGCTCTGGTGG - Intergenic
984671765 4:182497513-182497535 TTTTACACATATCACTTTAGTGG + Intronic
984857089 4:184204647-184204669 TTTGACACAGCTCTCCTTGGAGG + Intronic
984947462 4:184981168-184981190 TTTTACAAGGCCTTCTTTGGAGG + Intergenic
984960650 4:185094166-185094188 GTTTAGAAACATCTCCTTGGGGG - Intergenic
987796999 5:22640867-22640889 TTTTCCAAAGATGATTTTGGTGG - Intronic
988227802 5:28435301-28435323 TTTTACAAAGATTGCTTTGATGG + Intergenic
988458892 5:31414222-31414244 TTTTAGAAAGATTGTTTTGGCGG + Intronic
989131253 5:38109240-38109262 TTTTAAAAATATCTCTTTTAGGG + Intergenic
989424035 5:41274977-41274999 TTTTATAAAAATGACTTTGGTGG - Intergenic
990299996 5:54440677-54440699 TTTGAAAAAGCTGTCTTTGGAGG - Intergenic
990359426 5:55003457-55003479 TTTTAGAAATAACTTTTTGGGGG - Intronic
991128695 5:63096282-63096304 TTCTTCAAAGATTTCTTAGGAGG - Intergenic
992053698 5:72965966-72965988 TTTTTCAAAAAGTTCTTTGGAGG - Intronic
992125908 5:73641204-73641226 ACTTACACAAATCTCTTTGGTGG - Intronic
992293839 5:75307308-75307330 TTATGCAAAGGTCTATTTGGCGG + Intergenic
994802135 5:104391987-104392009 CCTTACAAAAATCTCTTTGTAGG + Intergenic
994867961 5:105302494-105302516 TGTTAAAAACATCTATTTGGGGG + Intergenic
994869205 5:105322656-105322678 TTTTAAAATTACCTCTTTGGAGG + Intergenic
994924572 5:106098201-106098223 TTTTAAAAACATGTTTTTGGGGG + Intergenic
995837692 5:116414691-116414713 GTTCACAAAGATCCCTTTGGTGG + Intergenic
995889227 5:116932199-116932221 TTTTAATAAAGTCTCTTTGGAGG - Intergenic
996198666 5:120642183-120642205 ATTTAAAAAGATCTTTTTGGTGG - Intronic
996319204 5:122194896-122194918 TTTTTCAAAGATTTTTTCGGGGG + Intergenic
997693656 5:135844782-135844804 ATTTATAAATTTCTCTTTGGGGG + Intronic
998078098 5:139252753-139252775 TTTTAAAAAGATCACTTGGCCGG - Intronic
999266142 5:150268165-150268187 TTTTAAAAAGAGCTCCTTGGTGG - Intronic
999676769 5:154012029-154012051 TTTTAGAAAGATCACTTTGGTGG + Intronic
1001884000 5:175271893-175271915 TTTTAAAACTGTCTCTTTGGCGG - Intergenic
1002179777 5:177425208-177425230 TTTTAAAAATATCACTCTGGTGG - Intronic
1003340378 6:5214516-5214538 TTTGAAAAAGATCACTGTGGTGG + Intronic
1003679863 6:8242234-8242256 TTTTACAAAGACCCCTTTCATGG + Intergenic
1003846173 6:10175826-10175848 TTTTACAAAGCTATCCTTAGAGG - Intronic
1003857422 6:10290547-10290569 TTTTACAAAGATATCTGTTATGG + Intergenic
1003919341 6:10818311-10818333 ATTTAAAAAGTTGTCTTTGGTGG + Intronic
1003953333 6:11139834-11139856 GTTTACAAAGAACTTTGTGGGGG + Intergenic
1004278676 6:14260100-14260122 TTTTAAAAAGATGTCCGTGGAGG - Intergenic
1006052020 6:31352597-31352619 TTTTAAAAGGATCTCTCTGACGG - Intronic
1007023757 6:38548822-38548844 TTTTACATTGCTCTCTTTAGAGG - Intronic
1007912210 6:45527359-45527381 TTTTTCAAAGCTCACTCTGGCGG + Intronic
1008353347 6:50519826-50519848 TTTCCCAAAGATTTCTTTAGTGG + Intergenic
1008791306 6:55238422-55238444 TTTTTCAAAGATTACTTAGGCGG - Intronic
1009939001 6:70267805-70267827 TTTCAAAAAGATTTCTTTGAGGG - Intronic
1010255241 6:73749895-73749917 TTTTAGGAAGATCACTTTGGTGG + Intronic
1011168099 6:84473355-84473377 TTTTGGAAAGATATCTTTGAGGG - Intergenic
1011793586 6:90927455-90927477 TTTTAGAAGGATCACTCTGGTGG + Intergenic
1012000016 6:93642647-93642669 TTTTACAATGATCTCTATGCTGG + Intergenic
1012479677 6:99652630-99652652 TTTTAGAAAGATCTCTCTGATGG - Intergenic
1012595965 6:101040132-101040154 TTATAACAAGATGTCTTTGGAGG - Intergenic
1012941692 6:105422482-105422504 TTCTCAAAAGAGCTCTTTGGAGG + Intergenic
1013784689 6:113766238-113766260 TTTTAGAGGGATTTCTTTGGTGG + Intergenic
1014642900 6:123935259-123935281 TTATACAAAGATATCTTTCTTGG + Intronic
1014759633 6:125342367-125342389 ATGAACAAAGATGTCTTTGGGGG + Intergenic
1015199503 6:130563484-130563506 TTTTAGAAAGATTTCTCTGTTGG + Intergenic
1017445831 6:154506466-154506488 TTTTTCAAAGAACTCTTTAAAGG + Intronic
1018167798 6:161115964-161115986 TTTTAGAAAGATCACTCTAGAGG + Intronic
1018217523 6:161544369-161544391 TTTTTCAAAGAGCTCTTTGTTGG + Intronic
1020611810 7:10407193-10407215 TTTTTCAAAGTTGTCTTTTGGGG - Intergenic
1021212889 7:17878219-17878241 TTTTACTAAGAATTCTATGGGGG - Intronic
1021313989 7:19123603-19123625 TTTTACTAAGGTATCTGTGGTGG - Intergenic
1021848250 7:24783612-24783634 TTTTAGAAAAATCACTCTGGTGG + Intergenic
1021881008 7:25095567-25095589 TAGGACATAGATCTCTTTGGGGG - Intergenic
1021892369 7:25198339-25198361 TTTTAGAAAAATCTCCCTGGTGG - Intergenic
1023351420 7:39323697-39323719 TTTTACAAAGATAATTCTGGTGG + Intronic
1023517581 7:41017468-41017490 TTTTAGAAAGATTTCACTGGAGG + Intergenic
1024092401 7:45955214-45955236 TTTTAGAAAGAACTCTTTGTAGG + Intergenic
1026216900 7:68357702-68357724 TTTTAGAAAGATCATTTTGTTGG + Intergenic
1027743186 7:82038774-82038796 TTTTAGAAATATCACTTTAGAGG + Intronic
1028452090 7:90996683-90996705 TCTTACTAAAATCTCTTTGTGGG + Intronic
1028482216 7:91319742-91319764 TGTTACAAAGTTTTATTTGGAGG - Intergenic
1029571743 7:101374336-101374358 CTTTACATAGATCACTCTGGAGG - Intronic
1029882919 7:103835879-103835901 TTTTAGAAAGATCACTCTGGTGG - Intronic
1030195890 7:106853297-106853319 TTTTGAAATGGTCTCTTTGGAGG + Intergenic
1030958516 7:115886148-115886170 TTTTACAAAAATGTCTTTGATGG - Intergenic
1031169559 7:118275401-118275423 TTTTAGAAAGCCCTTTTTGGGGG + Intergenic
1031192283 7:118568446-118568468 TTATAAAAAGATCACTTTAGGGG + Intergenic
1031773542 7:125877332-125877354 TTTTAGAAAGATTTATTGGGTGG + Intergenic
1032345574 7:131113523-131113545 TTTTAGAAAGATCTCTCAGCTGG + Intronic
1032689649 7:134271226-134271248 TATTACAAAGATCTTTTTCCAGG + Intergenic
1032809746 7:135400314-135400336 TTTTAGAAAGATTAATTTGGTGG + Intronic
1033012745 7:137639834-137639856 TTTTAAAAAAAATTCTTTGGGGG + Intronic
1033587623 7:142786251-142786273 CTTTACAAAAACCTCTCTGGCGG + Intergenic
1033780685 7:144665375-144665397 TTATACAAAGCTCTATTTTGGGG - Intronic
1034143047 7:148840561-148840583 TTTTACAATGATCTGTTCAGTGG + Intronic
1034166898 7:149032197-149032219 TTTTATAAAGATCACTCTGGGGG + Intergenic
1035615565 8:998610-998632 TTTTACTTTGATCTCTTTGCTGG + Intergenic
1037862422 8:22415270-22415292 TTTCAAAAAGATATCTTTAGTGG + Intronic
1038079044 8:24111417-24111439 TTTTACACAACTCTCTTTGAAGG + Intergenic
1038728412 8:30103004-30103026 GTTTACAAAGATATATTTAGTGG + Intronic
1038769129 8:30460084-30460106 TTAAACAAATATGTCTTTGGTGG + Intronic
1039867135 8:41515296-41515318 TTTTTTAAAGAACTCTTTGTAGG - Intergenic
1040739064 8:50549513-50549535 TTTTAGAAATATCTCTCTGTGGG - Intronic
1040811255 8:51456140-51456162 TTTTAGAAAAATGTCTCTGGTGG - Intronic
1041334238 8:56761872-56761894 TTTTACAAAGCTCAATCTGGAGG - Intergenic
1042443486 8:68856008-68856030 ATTTACTGAGATCTCCTTGGTGG - Intergenic
1043534807 8:81190873-81190895 TTTTAAAAAAATCTCTTCGTAGG - Intergenic
1043952815 8:86328132-86328154 TTTTTAAAAGATTTGTTTGGAGG - Intergenic
1044747223 8:95382563-95382585 ATTTAAAAAAATCTATTTGGTGG + Intergenic
1044859878 8:96512503-96512525 TATTAAACAGTTCTCTTTGGGGG - Intronic
1045030178 8:98127679-98127701 TTTTCTAAACATCCCTTTGGAGG - Exonic
1045087822 8:98706215-98706237 TTTTACAAGTATATTTTTGGGGG + Intronic
1045355540 8:101385538-101385560 TTTTACAAATTTTTTTTTGGGGG + Intergenic
1045420951 8:102014407-102014429 TCTTAAAACCATCTCTTTGGGGG + Intronic
1045427158 8:102078377-102078399 TTTTTAAAAGATCACTGTGGTGG - Intronic
1045918192 8:107498735-107498757 TTTTACAAGGATCTCTTTGGTGG + Intergenic
1046156646 8:110299318-110299340 TTTGACAGAGATAACTTTGGAGG + Intergenic
1046513079 8:115223158-115223180 TCTTGCCAAGATCTCTTTGTTGG + Intergenic
1047304547 8:123642345-123642367 TTTTAAAAAGATCACTCTGGCGG + Intergenic
1047338601 8:123958579-123958601 TTTTACAAAGATGTTTATGTAGG - Intronic
1047791448 8:128207838-128207860 TTTAACCAATTTCTCTTTGGGGG + Intergenic
1052350959 9:27457736-27457758 TTCCACATGGATCTCTTTGGTGG - Intronic
1052400783 9:27997692-27997714 TTTTGCAAAGATCTCCATTGTGG - Intronic
1052517529 9:29502654-29502676 GTTTACAAAGACTTCTTTGAGGG - Intergenic
1053240860 9:36493851-36493873 TTTTTGAAAAATCTCTTTGTTGG - Intergenic
1053391459 9:37739390-37739412 TTTGAGAAAGATCACTCTGGAGG + Intronic
1054842482 9:69758690-69758712 TTTTACAATCATCACCTTGGAGG + Intronic
1054957576 9:70930107-70930129 TTTTACATCCATCTGTTTGGGGG + Intronic
1055298227 9:74855377-74855399 TTTTAAAAAGATGTTTTTGATGG - Intronic
1056240041 9:84636104-84636126 TTTTAAACAGATCTCCTTGGGGG - Intergenic
1057799063 9:98178780-98178802 TCTTGCATAGATCACTTTGGAGG + Intronic
1058202361 9:102059974-102059996 CTTCAAAAATATCTCTTTGGGGG - Intergenic
1058245408 9:102617934-102617956 TAGTACACAGATGTCTTTGGGGG - Intergenic
1059226468 9:112677671-112677693 TTTTTAAAAGATCACTCTGGAGG + Intergenic
1059989104 9:119847871-119847893 TTATACTAGGATCTCTTTTGCGG - Intergenic
1060807461 9:126586647-126586669 TTTTAGAAAGACCTCGCTGGAGG + Intergenic
1186611509 X:11142533-11142555 TATGACACAGATATCTTTGGGGG - Intronic
1186778879 X:12893155-12893177 TGTTACTAAGTTCTGTTTGGTGG - Intergenic
1186860138 X:13664883-13664905 TTTTAAAAAGTTTACTTTGGCGG + Intronic
1188291809 X:28398664-28398686 TTTTACAATTATTGCTTTGGGGG + Intergenic
1188518660 X:31014000-31014022 TTTTAAAAAGATCTCCTCAGTGG - Intergenic
1188922557 X:35995398-35995420 TTTTTTAGAGATCACTTTGGTGG + Intergenic
1189075188 X:37906935-37906957 TTTTAGAAAAATCATTTTGGTGG + Intronic
1189745718 X:44166974-44166996 TTTTAGAAAGAGCACTGTGGTGG - Intronic
1194727909 X:97419779-97419801 TAAAACAAAGATGTCTTTGGAGG - Intronic
1195541993 X:106072977-106072999 TTTTTGAAAGATCTCTTTCGAGG - Intergenic
1195612865 X:106888963-106888985 TTTTACAAAGATATTTTTACTGG + Intronic
1195829584 X:109041223-109041245 TTTTAAAAAGGTGTATTTGGAGG + Intergenic
1196637277 X:118017077-118017099 TGCTAGAAAGATCACTTTGGTGG - Intronic
1197004911 X:121483818-121483840 ATTTACAAAGCTCTCTTTGTGGG + Intergenic
1197858604 X:130946285-130946307 TGTAACAAATATCTCTCTGGGGG - Intergenic
1198041322 X:132855663-132855685 TTTTACAAATTTCTAGTTGGTGG - Intronic
1199226520 X:145381903-145381925 TTTTAAACAGTTCTCTTTGAAGG + Intergenic
1199263329 X:145801275-145801297 TTTTACAAAATTCTCATTTGCGG - Intergenic
1199536736 X:148911241-148911263 TTTAAAAAAGATATCTTAGGTGG + Intronic
1199881534 X:151977330-151977352 GTTTCCAAAGATCCCTCTGGTGG + Intergenic
1200085187 X:153600686-153600708 TTTTAGAAAGCTCGCTCTGGCGG - Intergenic
1200385902 X:155890677-155890699 CTTTAGAAAGATCACTCTGGTGG + Intronic
1200844339 Y:7815980-7816002 TATTCCAAATATCTCTTTGTAGG + Intergenic
1200863415 Y:8017029-8017051 TTTTCCAAAATTCTCTTTGATGG + Intergenic