ID: 1102644191

View in Genome Browser
Species Human (GRCh38)
Location 12:114393283-114393305
Sequence CACCATCTCCACATCCATCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 230
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 206}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102644180_1102644191 26 Left 1102644180 12:114393234-114393256 CCACCCCAGCCTTGCTGGTGGGG 0: 1
1: 0
2: 4
3: 47
4: 349
Right 1102644191 12:114393283-114393305 CACCATCTCCACATCCATCTAGG 0: 1
1: 0
2: 2
3: 21
4: 206
1102644177_1102644191 29 Left 1102644177 12:114393231-114393253 CCTCCACCCCAGCCTTGCTGGTG 0: 1
1: 2
2: 6
3: 224
4: 1283
Right 1102644191 12:114393283-114393305 CACCATCTCCACATCCATCTAGG 0: 1
1: 0
2: 2
3: 21
4: 206
1102644183_1102644191 22 Left 1102644183 12:114393238-114393260 CCCAGCCTTGCTGGTGGGGACTG 0: 1
1: 0
2: 1
3: 21
4: 318
Right 1102644191 12:114393283-114393305 CACCATCTCCACATCCATCTAGG 0: 1
1: 0
2: 2
3: 21
4: 206
1102644182_1102644191 23 Left 1102644182 12:114393237-114393259 CCCCAGCCTTGCTGGTGGGGACT 0: 1
1: 0
2: 0
3: 31
4: 354
Right 1102644191 12:114393283-114393305 CACCATCTCCACATCCATCTAGG 0: 1
1: 0
2: 2
3: 21
4: 206
1102644184_1102644191 21 Left 1102644184 12:114393239-114393261 CCAGCCTTGCTGGTGGGGACTGT 0: 1
1: 0
2: 1
3: 21
4: 266
Right 1102644191 12:114393283-114393305 CACCATCTCCACATCCATCTAGG 0: 1
1: 0
2: 2
3: 21
4: 206
1102644185_1102644191 17 Left 1102644185 12:114393243-114393265 CCTTGCTGGTGGGGACTGTAGCT 0: 1
1: 0
2: 0
3: 22
4: 166
Right 1102644191 12:114393283-114393305 CACCATCTCCACATCCATCTAGG 0: 1
1: 0
2: 2
3: 21
4: 206
1102644176_1102644191 30 Left 1102644176 12:114393230-114393252 CCCTCCACCCCAGCCTTGCTGGT 0: 1
1: 0
2: 6
3: 100
4: 1068
Right 1102644191 12:114393283-114393305 CACCATCTCCACATCCATCTAGG 0: 1
1: 0
2: 2
3: 21
4: 206

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102644191 Original CRISPR CACCATCTCCACATCCATCT AGG Intronic
900437257 1:2636953-2636975 CAGCATCTCCTCATTCTTCTTGG - Intronic
900989202 1:6090328-6090350 CTCCATCTCCACAGGCACCTGGG - Intronic
901122341 1:6905982-6906004 CACCAGCTCCACATCCCTTCAGG - Intronic
901329900 1:8398402-8398424 CACCATCTCCCCATCACTCAAGG + Intronic
902387367 1:16083516-16083538 CTCCGTCTCCACAACCATCCAGG + Intergenic
904442540 1:30541019-30541041 CACCATCACAACAGCCATCTTGG - Intergenic
904574479 1:31495149-31495171 CACAATCTCTGCATCCATCCAGG - Intergenic
907946110 1:59138025-59138047 CACCATCCCCACCTCCTCCTTGG + Intergenic
910769464 1:90816402-90816424 AACCATCTCCATTTCCATCTGGG + Intergenic
911471230 1:98320894-98320916 CACCATATCCATGTTCATCTAGG - Intergenic
914093317 1:144523674-144523696 CACCACCTTCACATCCGTGTAGG - Intergenic
914675592 1:149905118-149905140 CAGCATCTTCACATCCTTCGTGG - Exonic
915233995 1:154466997-154467019 CACCCTCTCCATAACCACCTGGG - Exonic
918244413 1:182646368-182646390 CACCACCTCCACACCCTCCTCGG - Intronic
919594858 1:199548505-199548527 CACCATCCCCAAATCTATGTTGG + Intergenic
919728839 1:200900380-200900402 CCCCTTCTCCACAGCCATTTGGG - Intronic
921302590 1:213765059-213765081 CACCCTCTCCACAGCCACCGAGG + Intergenic
1066056550 10:31686444-31686466 CACAGTCTCCACGCCCATCTTGG + Intergenic
1070837559 10:79459617-79459639 CACTATCTTTTCATCCATCTGGG + Intergenic
1074058827 10:109946277-109946299 CTCCATCCCCACTTCCATCCTGG + Intronic
1074692594 10:116019711-116019733 CACCATCTCCAACTCCAACTGGG - Intergenic
1074906022 10:117864712-117864734 CACCCCAACCACATCCATCTGGG + Intergenic
1076275197 10:129192606-129192628 GGCCGTCTCCACCTCCATCTGGG + Intergenic
1076666653 10:132096988-132097010 GGCCATCTGCACATCCATGTCGG - Intergenic
1077233930 11:1470851-1470873 CACCATCGCCACCTCCGTCCTGG - Intronic
1077554431 11:3219096-3219118 CACCCTCACCACATCCATGAGGG - Intergenic
1077604594 11:3600349-3600371 CTGCATGTCCACAACCATCTTGG + Intergenic
1077819282 11:5720102-5720124 CCCCATGTCCACATCATTCTTGG + Intronic
1078015087 11:7606380-7606402 CCCCATCTCCAGATCCAGCAAGG - Intronic
1079995957 11:27295399-27295421 CACCTTCTCCAGATACATTTGGG + Intergenic
1080247168 11:30192589-30192611 CTCCCTCCCCACTTCCATCTTGG + Intergenic
1080475555 11:32586859-32586881 CTCCCTCACCTCATCCATCTTGG - Intronic
1080561929 11:33472062-33472084 CATCATCTCCACATTCCTGTTGG + Intergenic
1082085908 11:48049343-48049365 CTCCATCTCCACGTACATCCTGG - Intronic
1083871153 11:65489329-65489351 CCCCAGCTCCACATTCTTCTAGG + Intergenic
1084904539 11:72335511-72335533 CACCAACCCCACTTCCATCTTGG + Intronic
1086104000 11:83129609-83129631 CACCATCTCTACTACCATCTTGG - Intergenic
1086228910 11:84545377-84545399 CACCATATCCACAACCACCACGG + Intronic
1087524166 11:99286450-99286472 CACGTTCTCCTTATCCATCTTGG - Intronic
1087612142 11:100447425-100447447 CACTCTCTTCACAGCCATCTTGG - Intergenic
1087796064 11:102455504-102455526 TCCCATCTCCCCACCCATCTGGG + Intronic
1089332319 11:117698541-117698563 CAATTTCTCCACATCCACCTGGG + Intronic
1092195413 12:6546837-6546859 CACCAGCTCCACTTGCCTCTAGG + Intronic
1094812219 12:34149605-34149627 CAAAATCTCCAGATACATCTGGG + Intergenic
1098270099 12:68761807-68761829 CTCTTTCTCCACATCCAACTCGG - Intronic
1098466360 12:70790979-70791001 TACCACCTCCACATCTATCATGG + Intronic
1101437999 12:104680411-104680433 CCCCATCCCCACATTCATCAGGG - Intronic
1102644191 12:114393283-114393305 CACCATCTCCACATCCATCTAGG + Intronic
1103316044 12:120056771-120056793 CCAGGTCTCCACATCCATCTAGG - Intronic
1104391926 12:128398031-128398053 CACCAGCAAGACATCCATCTCGG - Intronic
1105851579 13:24340388-24340410 CACCTTCTCCTCCTCCAACTTGG - Intergenic
1107061066 13:36160381-36160403 CAGCCTCTCCACTTCCAGCTTGG - Intergenic
1107684182 13:42880096-42880118 CATAATCTCTACACCCATCTTGG + Intergenic
1109887583 13:68561942-68561964 TGCCATCTCCACATCCACTTTGG + Intergenic
1111848195 13:93538416-93538438 CTCCATCTCCTCATCTCTCTAGG - Intronic
1119720436 14:76886200-76886222 CTCCACCTCCCCACCCATCTTGG + Intergenic
1120003229 14:79327425-79327447 CACCATCTACATGGCCATCTGGG + Intronic
1122151067 14:99726552-99726574 GACCACCTTCACCTCCATCTGGG - Exonic
1122488241 14:102095828-102095850 CACCATTTCCACTTCCAGCTGGG + Intronic
1124090213 15:26592330-26592352 CAAGATCACCACATCCATATTGG + Intronic
1125957543 15:43800630-43800652 CTCCAGCTCCACATCCCCCTCGG - Exonic
1129804301 15:78442065-78442087 CACCATCTCTACAACTAGCTGGG - Intronic
1130017936 15:80201793-80201815 CGCCATCCCCACATCCACCTGGG - Intergenic
1130133196 15:81160667-81160689 CACCATCTCCAGCTCCTTCTGGG - Intronic
1132700025 16:1218397-1218419 CGCCATCTCCAGCTCGATCTCGG - Exonic
1135086784 16:19481501-19481523 CACCAGCTCCACAGTCATGTGGG - Intronic
1135652591 16:24219021-24219043 CATCATCACCACACCCACCTGGG - Exonic
1137401458 16:48156998-48157020 CTCCATTTCCACCTCCCTCTAGG - Intergenic
1137834675 16:51580064-51580086 CCCCATCTTCACATTCTTCTTGG + Intergenic
1139387091 16:66579648-66579670 CACCAGCTCCACCTCCACCCGGG + Exonic
1139582609 16:67882340-67882362 CACCACCTCCACCCACATCTTGG - Intronic
1142160030 16:88552568-88552590 CTCCATGTCCAAATCCTTCTCGG + Intergenic
1144255899 17:13466787-13466809 CTCCATCTTCACATCCTTCCAGG - Intergenic
1148213381 17:45821269-45821291 ATCCATCTACGCATCCATCTGGG + Intronic
1148747167 17:49924820-49924842 CACCATCTCCAGATCTTTGTCGG - Intergenic
1150867351 17:68867066-68867088 CACCAACTCCACATACTTCCTGG - Intergenic
1152355500 17:79804989-79805011 CACCATCGCCCCATCCATCCTGG + Intergenic
1153847046 18:9059599-9059621 AACCCTCTCCTCATCCCTCTAGG + Intergenic
1156498233 18:37540210-37540232 CAACCTCTCCACATCCTCCTGGG - Intronic
1159100748 18:63955741-63955763 AACCATGTCGAGATCCATCTAGG + Intronic
1161388132 19:4007756-4007778 CACCAGCTCCGCCGCCATCTTGG - Exonic
1161852221 19:6743579-6743601 CACCTTCTCCACATCAGCCTTGG - Exonic
1161882741 19:6968214-6968236 CACCACTTCCACATCTATTTGGG + Intergenic
1162808315 19:13150345-13150367 CGCCCTCTCCTCAGCCATCTTGG + Intronic
1163010554 19:14422919-14422941 CACCATGCCCAGACCCATCTAGG - Intergenic
1163805042 19:19390983-19391005 TAGCATCTCCACAGCCCTCTGGG - Intronic
1167132205 19:47594250-47594272 CACCATCTCCCCAGACCTCTCGG + Intergenic
1167352424 19:48983901-48983923 CACCACCCCCACAGCCTTCTGGG + Intronic
925194238 2:1910426-1910448 CACCAGCTCCACCTGCATCAGGG - Intronic
925714582 2:6772563-6772585 CTCCATCTGCAGATCCACCTAGG - Intergenic
926695330 2:15766740-15766762 GCCCATCTCCACCTCCATCCAGG - Intergenic
926768606 2:16347899-16347921 ATCCATGTCCACATCCATCTTGG - Intergenic
927083151 2:19650209-19650231 CCCCATCTCCTCATCCTCCTCGG - Intergenic
929444946 2:41994306-41994328 CACCCTCACCACAACCCTCTGGG - Intergenic
929958809 2:46480592-46480614 CACCTTCTCCAGCTCCATCTCGG - Exonic
930252357 2:49048950-49048972 CATCACAACCACATCCATCTGGG - Intronic
930584196 2:53250383-53250405 CACCATCTCCACTTTCTTCGGGG - Intergenic
932290240 2:70570952-70570974 CACAGCCTCCACATCCTTCTGGG - Intergenic
934158666 2:89227527-89227549 AACCATGTCAACATCTATCTTGG - Intergenic
934208608 2:89954900-89954922 AACCATGTCAACATCTATCTTGG + Intergenic
935338352 2:102037171-102037193 CAACACCTCCACGTCCATCTAGG + Intergenic
936651245 2:114428912-114428934 CACCTTCTCCACATCTATCCTGG + Intergenic
936893873 2:117404912-117404934 CACCAGATCCACAGCTATCTTGG - Intergenic
937908227 2:127062951-127062973 CATCATCACTTCATCCATCTGGG + Intronic
938155638 2:128937856-128937878 TACAATCTCCTCATTCATCTTGG + Intergenic
939474519 2:142669808-142669830 CATCATCTGAACATGCATCTGGG - Intergenic
946477552 2:220023094-220023116 GACCATCTTCACTCCCATCTAGG - Intergenic
947907859 2:233778622-233778644 CACCATCTCGACATCTATGTTGG + Intronic
1168754080 20:304048-304070 CACCATCTCCTTTTCCATCAGGG - Intergenic
1169445945 20:5671218-5671240 CACCACCACCACCACCATCTGGG - Intergenic
1169926200 20:10787180-10787202 CACCATCTGCACATAATTCTAGG - Intergenic
1170415347 20:16133521-16133543 AACCTTCTCCACATGCAGCTTGG + Intergenic
1173812976 20:45967822-45967844 CACCACCACCACCTCCATCATGG + Exonic
1175266168 20:57704752-57704774 CACCATCTCCACTCCCATCGTGG - Intronic
1176122013 20:63458246-63458268 CAGCTTCTCCACATGCTTCTGGG - Intronic
1182146381 22:27999209-27999231 CTCCAGCTCCACATCCATGGCGG - Exonic
1184245897 22:43235582-43235604 CAGCATCTCCAGAACAATCTGGG - Intronic
1184654843 22:45935854-45935876 CCCCATCACCACACACATCTAGG - Intronic
950190279 3:10971788-10971810 CACCACGTCCACATCCAGCATGG + Intergenic
950390867 3:12695546-12695568 CACATTCTGCACATGCATCTTGG + Intergenic
950673602 3:14541268-14541290 CACCATCACCCCACCCTTCTTGG - Intronic
953390645 3:42531848-42531870 CCCCATCCTCACCTCCATCTTGG + Exonic
954442207 3:50527985-50528007 CACCATCTCCATCTCCTGCTTGG + Intergenic
959474428 3:106791380-106791402 CAGCATCTCTAGATCCAGCTGGG + Intergenic
961272997 3:125703610-125703632 CCCCATGTCCACAATCATCTTGG - Intergenic
962354273 3:134680462-134680484 AACCATGTGCACATCCAGCTGGG + Intronic
962378907 3:134880993-134881015 CACCATTTCCACACTCACCTTGG + Intronic
964872272 3:161326097-161326119 CACCATCCCCACTTCCACTTTGG - Intergenic
965855970 3:173088603-173088625 CAGCATGTCTAAATCCATCTTGG - Intronic
965986435 3:174759401-174759423 CACCATGTTCAAATCAATCTAGG - Intronic
966126273 3:176580458-176580480 CATCACCTCCACCTCCATCATGG - Intergenic
967240719 3:187436732-187436754 CACCCCCTCCACTTCCTTCTAGG + Intergenic
968058139 3:195708759-195708781 CACCATCTGCAGCACCATCTTGG - Intergenic
969196275 4:5566299-5566321 CTCCATCTCCACCACCACCTGGG - Intronic
969828201 4:9774958-9774980 CAGCATCTACACATCAATCCAGG + Intronic
971253072 4:24989351-24989373 GACATTCTGCACATCCATCTGGG - Intergenic
973621741 4:52734119-52734141 ATCCATCTCCACTTCCATCCTGG + Intronic
973675568 4:53258454-53258476 CATCATCTCCAATTCCATCAAGG + Intronic
980845538 4:138319768-138319790 CATTATCTCAACATCTATCTTGG - Intergenic
983329557 4:166307273-166307295 AACCACCTCCAATTCCATCTAGG - Intergenic
984369060 4:178838338-178838360 CAGCATCTCCAGATCAATTTAGG - Intergenic
984859677 4:184226755-184226777 CACCATCTTCCTATCAATCTAGG - Intergenic
985877856 5:2613698-2613720 CACCTTCTGCACATGCATCCCGG - Intergenic
986172331 5:5324971-5324993 CAACATCACAACATCCAACTGGG + Intergenic
986895980 5:12368724-12368746 TTCCATCCCCACATCCAGCTTGG - Intergenic
988088850 5:26508497-26508519 CAGCATATCCACATTCTTCTTGG + Intergenic
988254660 5:28806794-28806816 CTCCATCTTCTCATCCATCATGG - Intergenic
988552617 5:32210312-32210334 CACCCTCTCCACACCGAGCTTGG - Intergenic
989459721 5:41683488-41683510 CAGCATATCCTCATCCTTCTTGG - Intergenic
992221755 5:74580446-74580468 CATCACCTCCACAGCCCTCTTGG + Intergenic
992603644 5:78433114-78433136 CCCCATCTCCTCATGCATGTTGG + Intronic
993506983 5:88721254-88721276 CACCATTTCACCATGCATCTTGG - Exonic
994784064 5:104132961-104132983 CTCCATCTAGTCATCCATCTTGG + Intergenic
995020389 5:107360738-107360760 CATCATGTCCACATCCAGGTAGG + Intergenic
997436063 5:133876556-133876578 CACCAGCTCCACACCCACCTGGG + Intergenic
997782794 5:136676782-136676804 CACCATCTCCAGATCCCTGAAGG + Intergenic
998171106 5:139872476-139872498 CCCCATCTCCATAAGCATCTGGG + Intronic
998994829 5:147860164-147860186 CAGCTTCTCCACATCTTTCTAGG - Intergenic
1000474379 5:161686984-161687006 CACCATCTCCACATCTGACACGG - Exonic
1002014413 5:176308058-176308080 CACCACCTGCACTGCCATCTTGG - Intronic
1002860411 6:1074842-1074864 CACCAACTGCACATACATCAGGG + Intergenic
1003379385 6:5609475-5609497 CACCATATCCACCACCATCATGG + Intronic
1008076010 6:47146942-47146964 CACCATCTCCTACTCCCTCTAGG - Intergenic
1011052575 6:83169650-83169672 TGCCATCTCCTCATCCATCATGG + Intronic
1011400380 6:86954935-86954957 CACCATCTCAAGATGTATCTGGG + Intronic
1011816650 6:91199115-91199137 CATCCTCTCCACATCCCTCAAGG - Intergenic
1011944698 6:92886174-92886196 CACCTTCTGCACATGTATCTTGG + Intergenic
1012209892 6:96506732-96506754 TACCATATCCATATCCAGCTAGG + Intergenic
1016886480 6:148964324-148964346 CAACATCTCCCCTTCCCTCTAGG - Intronic
1018347850 6:162921389-162921411 CACTATATCCTTATCCATCTTGG + Intronic
1018492417 6:164307639-164307661 AACCATCACCACTGCCATCTGGG - Intergenic
1019413142 7:915327-915349 CACCATCCTCACACCCATCCAGG + Intronic
1019585854 7:1803013-1803035 CACCATCTCCACCCCCAGCCAGG - Intergenic
1021728230 7:23570839-23570861 GATCATCCCCACGTCCATCTGGG - Intergenic
1022830587 7:34061842-34061864 CACCATCTTCATCACCATCTGGG + Intronic
1024842251 7:53600700-53600722 CACCACATCCACATACAGCTGGG + Intergenic
1024946255 7:54810130-54810152 AAACATTTCCACATCTATCTGGG - Intergenic
1025923743 7:65939398-65939420 CACCATATCCACCACCATCATGG - Intronic
1026015559 7:66668498-66668520 CTCCATCTCCACAACCATCTGGG - Intronic
1026775111 7:73226423-73226445 CATCAACCCCACATCCTTCTGGG - Intergenic
1026891972 7:73987662-73987684 CTCCATCTCCACAACCATCTGGG - Intergenic
1027015968 7:74779794-74779816 CATCAACCCCACATCCTTCTGGG - Intronic
1027072061 7:75166143-75166165 CATCAACCCCACATCCTTCTGGG + Intergenic
1027632358 7:80622224-80622246 CACCATATCCTCATTCTTCTGGG + Intronic
1030906263 7:115187270-115187292 CACCTTCTGCACATCTATCACGG - Intergenic
1031599844 7:123692842-123692864 CACCACCTCCACCACCATCAAGG - Exonic
1031972462 7:128074497-128074519 CTCCACCTCCACCTCCACCTGGG - Exonic
1033406074 7:141072833-141072855 CACCCTCTCCCCATTCATCTCGG + Intergenic
1034122083 7:148637231-148637253 CTCCAGCTCCACATCCCCCTCGG - Intergenic
1035267222 7:157696809-157696831 CACCATCTACACATGCATACTGG + Intronic
1038336774 8:26651916-26651938 CACCATCTCCAGCTCCATTCCGG - Intronic
1040771505 8:50982991-50983013 CACCCTCCCCACATTCATCATGG + Intergenic
1041414606 8:57594138-57594160 CTCCATTTCCACATGAATCTCGG + Intergenic
1041971082 8:63743314-63743336 CACCATCCACACATATATCTAGG + Intergenic
1042045159 8:64642818-64642840 GTCCAACTCAACATCCATCTTGG + Intronic
1043278302 8:78430223-78430245 CTCCATCTGCCCATCTATCTAGG + Intergenic
1045001213 8:97879673-97879695 CCCCATCTGCCCAGCCATCTAGG - Intronic
1045183594 8:99813315-99813337 CAGAATCTCCACAACCATCTGGG - Intronic
1045575483 8:103415442-103415464 CAGCATCTTCACCTTCATCTCGG - Exonic
1046026894 8:108735282-108735304 AACCATCACCACAACCATTTTGG + Intronic
1046061869 8:109149824-109149846 TCCCTTCTCCACATCCATATGGG - Intergenic
1047411377 8:124627373-124627395 CACCTTCTCCACAACCCTCAAGG + Intronic
1047584882 8:126260531-126260553 CACCATATCCTCATTCTTCTTGG - Intergenic
1048847557 8:138615101-138615123 CACCAGCTCCACATCCCCCAGGG - Intronic
1049839337 8:144761021-144761043 CTCCTTCTCCACATCCAGCCAGG - Intergenic
1050709216 9:8440952-8440974 CAACATCTCAACATGCAGCTTGG + Intronic
1053391257 9:37738180-37738202 TCCCATCTCCACATTCATCATGG - Intronic
1056255881 9:84799127-84799149 CTCCATCTTCACATCAATCAAGG + Intronic
1056658952 9:88530890-88530912 CCCCATCTCCACCTCCACCCAGG - Intergenic
1057070772 9:92098113-92098135 CGCCATCTCGGCAGCCATCTTGG + Intronic
1059281104 9:113135001-113135023 CTCCCTCTCCACATCAATCAGGG - Intergenic
1059305550 9:113350470-113350492 CGCCACCTCCACTTCCAGCTCGG + Intronic
1060616876 9:125024752-125024774 CACCTTCTCCATATCCAACCAGG + Intronic
1061896451 9:133651015-133651037 CCCCATGGTCACATCCATCTTGG + Intronic
1203776295 EBV:75069-75091 CACCTTCTCCATCTCCATCAGGG - Intergenic
1185845169 X:3431029-3431051 CACCTTCTCCAAATCCCTCTGGG + Intergenic
1186093614 X:6076374-6076396 CAACAACTATACATCCATCTAGG + Intronic
1186759030 X:12703746-12703768 CAGCATCTCCACATCAATACTGG + Intronic
1188546618 X:31314435-31314457 CAGCTTATCCACATCCATCTTGG - Intronic
1192152703 X:68722025-68722047 CACCACCTCCTGCTCCATCTAGG + Exonic
1192333652 X:70200017-70200039 CCCCACCTGCCCATCCATCTTGG - Intronic
1195023833 X:100855691-100855713 CACCATATCCACCACCATCATGG + Intronic
1196705000 X:118709871-118709893 CACCACGTCCACTTCCACCTCGG + Intergenic
1197436464 X:126434216-126434238 CACCATCTATACATTCACCTTGG - Intergenic
1197610491 X:128632965-128632987 CACCCTCTCTACATGCATCATGG + Intergenic
1198789104 X:140323295-140323317 CACCATCTGCATATCCTTCTTGG - Intergenic
1199855168 X:151753766-151753788 CCTCATCTCCACATCCCCCTTGG + Intergenic
1199920608 X:152398905-152398927 GACTATCTCCACACACATCTTGG - Intronic
1200310410 X:155071523-155071545 CACCACCTGCACCGCCATCTTGG - Exonic
1200857598 Y:7956056-7956078 CACCATTTCCAATTTCATCTGGG - Intergenic