ID: 1102644205

View in Genome Browser
Species Human (GRCh38)
Location 12:114393338-114393360
Sequence CTCTGGAAGGGCAAAGTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 37698
Summary {0: 2, 1: 9, 2: 199, 3: 3838, 4: 33650}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102644205 Original CRISPR CTCTGGAAGGGCAAAGTGGG AGG (reversed) Intronic
Too many off-targets to display for this crispr