ID: 1102646164

View in Genome Browser
Species Human (GRCh38)
Location 12:114405350-114405372
Sequence GCTCCCCGGGACCCTGGCGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 195
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 173}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102646164_1102646174 7 Left 1102646164 12:114405350-114405372 CCCTCGCCAGGGTCCCGGGGAGC 0: 1
1: 0
2: 1
3: 20
4: 173
Right 1102646174 12:114405380-114405402 TGGCGGAGGCGAACAAGATGCGG 0: 1
1: 0
2: 0
3: 6
4: 85
1102646164_1102646175 22 Left 1102646164 12:114405350-114405372 CCCTCGCCAGGGTCCCGGGGAGC 0: 1
1: 0
2: 1
3: 20
4: 173
Right 1102646175 12:114405395-114405417 AGATGCGGTTTGACAGAACCAGG 0: 1
1: 0
2: 1
3: 3
4: 62
1102646164_1102646171 -10 Left 1102646164 12:114405350-114405372 CCCTCGCCAGGGTCCCGGGGAGC 0: 1
1: 0
2: 1
3: 20
4: 173
Right 1102646171 12:114405363-114405385 CCCGGGGAGCTCTGGGCTGGCGG 0: 1
1: 1
2: 3
3: 62
4: 488
1102646164_1102646173 -7 Left 1102646164 12:114405350-114405372 CCCTCGCCAGGGTCCCGGGGAGC 0: 1
1: 0
2: 1
3: 20
4: 173
Right 1102646173 12:114405366-114405388 GGGGAGCTCTGGGCTGGCGGAGG 0: 1
1: 0
2: 4
3: 63
4: 641

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102646164 Original CRISPR GCTCCCCGGGACCCTGGCGA GGG (reversed) Intronic
901628296 1:10635834-10635856 GCTTCCTGGGACCTTGGGGAGGG - Intergenic
902448789 1:16484121-16484143 CCTCCCCCGGACCCTGGCCCCGG + Intergenic
902747191 1:18481942-18481964 GTTCCCAGGGACCCTGGCGGTGG - Exonic
902768100 1:18630325-18630347 GCTCCCCGGGAACCGGCCTAGGG - Intergenic
903749082 1:25608592-25608614 GGTCACCGGGGCCCTGGCGGAGG + Intergenic
904365514 1:30008566-30008588 CCTCCCCTGGAGCCTGGCAAAGG + Intergenic
905769101 1:40625861-40625883 CCTCCCCAGGGCCCTGGCCAGGG + Exonic
905883047 1:41476889-41476911 GGCCCCGGGGACCCTGGCCAGGG - Intergenic
912333925 1:108845271-108845293 GCTCCCCTGGGCCCTGGCTTTGG + Intronic
914359223 1:146916673-146916695 GCTACCCGGGAGACTGACGAAGG + Intergenic
914494525 1:148183203-148183225 GCTACCCGGGAGACTGACGAAGG - Intergenic
914753207 1:150549507-150549529 CCTCCCCGGGACCCCGGCCCCGG + Intronic
916651675 1:166839641-166839663 GCCGCCCGGGACCCGGGGGAGGG - Intronic
920052695 1:203173220-203173242 GCTCCCTGGTTCCCTGGGGAAGG + Intronic
920096813 1:203491861-203491883 GCTCCCCAAGAGCCTGGCAAAGG - Intergenic
922915136 1:229251334-229251356 GCTCCCCGTGCCCCTGGTGCTGG - Exonic
1062982511 10:1737130-1737152 GCTCCCCAGGACCGAGGCCATGG + Exonic
1065727070 10:28677232-28677254 GCTCCCCCGGCGCCTCGCGAAGG + Intergenic
1068960635 10:62863331-62863353 GCTCCCCATGACCCTTGAGATGG + Intronic
1069738403 10:70672472-70672494 ACTCCGCGGGAGCCGGGCGACGG - Intergenic
1070194038 10:74140060-74140082 GCTCCCAAGCACCCTGGCCAGGG - Intronic
1072685275 10:97532969-97532991 CCTCCCCTGGACCCTGACCATGG - Intronic
1073043217 10:100621443-100621465 GCTCCCCGGGCCTCTGCTGAGGG + Intergenic
1073491211 10:103854826-103854848 GCGCCCAGGGCCCCTGGGGAGGG + Intronic
1074686891 10:115970005-115970027 CCTCCCAGGGACCCTTGCAAAGG + Intergenic
1075697550 10:124447900-124447922 GCTCCCCGCGTCCCAGGCGCCGG - Exonic
1076744098 10:132504143-132504165 GCTGCCCAGGACCCTGGGGCTGG + Intergenic
1077028146 11:450781-450803 GCTCCCCGGGACCCGGGGGGCGG - Intronic
1077106299 11:843964-843986 GCTGCCCAGGGCCCTGGCCAGGG - Intronic
1077350928 11:2092878-2092900 GCTCCCTGGGCAGCTGGCGAGGG - Intergenic
1077352529 11:2099556-2099578 GCTCCCTGGGACCCTCCCCATGG + Intergenic
1078148756 11:8741086-8741108 GCTGCCCTGGACCCTGTTGAGGG - Intronic
1080836371 11:35944290-35944312 GCTGGCCCGGACCCTGCCGAGGG + Intronic
1081584567 11:44375546-44375568 GTTGCCTGGGACCCTGACGATGG + Intergenic
1081879503 11:46436154-46436176 GATCACCTGGACTCTGGCGAGGG - Intronic
1083541042 11:63511671-63511693 GCTCCCCTGGCCCCCGGGGATGG + Intronic
1083780025 11:64913012-64913034 GGTCCCCAGGCCCCTGGGGAGGG - Intronic
1084621210 11:70271141-70271163 GCGCCCCGTGACCCGGGCGCTGG + Intronic
1084756412 11:71241658-71241680 GCTCCCTGGGAACCTGGTGGGGG - Intronic
1089168876 11:116498954-116498976 GCTCCAGGGGACCCTGCCCAGGG + Intergenic
1089397363 11:118145197-118145219 GCTCCCCGTAACCCTGTCGCTGG - Exonic
1089656116 11:119948117-119948139 CCTCCCCGGGGCCCAGCCGAGGG + Intergenic
1090375070 11:126282834-126282856 GCGCCGGGGGACCCTGGCCACGG + Intergenic
1091265432 11:134267404-134267426 GTTCCCCAGTACCCTGGCAAGGG + Intergenic
1095981835 12:47978557-47978579 GCTCCCAGGGACCTTGGCATGGG + Intronic
1096839206 12:54370414-54370436 GCTCCCCAGCCCCCTGGCGGTGG - Exonic
1099014271 12:77325597-77325619 CCTCCCCGTGACCCCGGCGCAGG - Intergenic
1100367699 12:93936772-93936794 CCTCCCCAGCACCCTGGCCAAGG - Intergenic
1102646164 12:114405350-114405372 GCTCCCCGGGACCCTGGCGAGGG - Intronic
1104049874 12:125187580-125187602 GCTCCCCGGTGCCCAGGCAATGG - Intronic
1104331755 12:127853438-127853460 CCACCCCAGGACCCTGGCTATGG - Intergenic
1104945991 12:132415121-132415143 GATCCCAGGGCTCCTGGCGACGG - Intergenic
1105058992 12:133130415-133130437 GCGCCCCGGGACCCTAGAGCCGG - Exonic
1105650297 13:22370099-22370121 GCTCCTGGGGAGCCTGGGGATGG - Intergenic
1112043922 13:95576192-95576214 GCTCCCCTGCACCCTGAGGAAGG + Intronic
1121883340 14:97519878-97519900 GCTCTCCTGGACCCTGTTGAAGG + Intergenic
1122154380 14:99741654-99741676 GCTGCCCTGGTCCCTGGTGAGGG - Intronic
1122693862 14:103543572-103543594 GGTCACCTGGACCCTGGGGACGG - Intergenic
1125720481 15:41842804-41842826 GCTCCCCGGGTGCCTGGCACTGG - Intronic
1125832440 15:42726374-42726396 GGGCCACGGGACCCTGACGAGGG - Exonic
1131098986 15:89673451-89673473 GCTTCCCGGGAGGCTGGAGAGGG - Intronic
1133306338 16:4811975-4811997 TCTGCCGGGGACCCTGGGGAAGG - Intronic
1134015997 16:10888811-10888833 GCCCCCCAGCACCCCGGCGAGGG - Intronic
1134088054 16:11372146-11372168 GCTTCAGGGGACCCTGGGGAGGG - Exonic
1139422011 16:66854798-66854820 GCTCCCCGTCAGCCTGGGGAGGG - Intronic
1139952509 16:70679132-70679154 GCCCCCGGGGTCCCTGGCCAGGG - Intronic
1140322527 16:73967038-73967060 GTCCCCCGGGACCCTGGTGGTGG - Intergenic
1140469858 16:75207882-75207904 GCTCGCCGGGTCCCAGGGGATGG + Intergenic
1141466103 16:84206737-84206759 TCTCCCAGGGACCCTGGAGCTGG + Intergenic
1141921908 16:87141069-87141091 TCTCCCCGGGACCCTGGCGCCGG + Intronic
1142688526 17:1591500-1591522 GCTGCCCGGGACCCCGGCTGGGG + Intronic
1144586901 17:16492413-16492435 GCTTCCCGGGGCCGTGGCGCGGG + Intergenic
1147905020 17:43816987-43817009 GCTCCCTGGGCCCCTGACAATGG - Intronic
1148622438 17:49044506-49044528 TCTCCCCTGGACCTTGGCCAGGG - Intronic
1148776353 17:50097600-50097622 GAGCCCAGGGACACTGGCGATGG - Intronic
1150768360 17:68020402-68020424 GCTCCCCGGGACCCTCTGCAGGG + Intergenic
1151322871 17:73361932-73361954 GGGCCCCGGGACCCTGGGTAGGG + Intronic
1152592371 17:81220018-81220040 GCGCTCCGGGACGCTGCCGATGG + Exonic
1152627160 17:81393154-81393176 GCTCCGCGGGTCCCCGGCGACGG + Intergenic
1153805485 18:8705916-8705938 GCGGCCAGGGACCCCGGCGAGGG - Intronic
1154343758 18:13525719-13525741 TCTCCCTGGGACCCAGGCGCAGG - Intronic
1155004337 18:21714516-21714538 ACTCCCAAGGACCCTGGAGAAGG - Intronic
1156461973 18:37326324-37326346 GCCCCCTGGGACCCTGGCCATGG + Intronic
1160690947 19:460550-460572 GGGCCCCAGGACCCTGGCGTCGG + Exonic
1161056853 19:2195050-2195072 CCTCCCATGGACCCTGGGGATGG + Intronic
1161265653 19:3362746-3362768 GCTCCCCAGGAACCTTGCAAGGG - Intronic
1161405955 19:4091154-4091176 GCTCCGGGGGACCCTGGCAATGG - Intronic
1161485165 19:4531597-4531619 GCTCCCAGGGACACGGGCCAGGG + Intronic
1161575624 19:5052799-5052821 GCGCCCGGGGACCCTGGTGTGGG + Intronic
1162127365 19:8506677-8506699 GGCCCCCGGGACCCTGGAGAGGG + Intergenic
1165417289 19:35702629-35702651 GCACCTCGGGAGACTGGCGAGGG + Intergenic
1165895467 19:39138694-39138716 CCGCCCCTGGACCCTGGCGGAGG + Intronic
1167134908 19:47610143-47610165 CCTCCCCGGGCCCCTGCGGAGGG + Intronic
1167751497 19:51383144-51383166 GCTACTCGGGACCCTGAGGAAGG - Intronic
1168076403 19:53982774-53982796 CGCCCCCGGGACCCTGGCCAAGG + Exonic
1168297339 19:55383841-55383863 GCTCTCCGGGAGCCGGGCGCGGG + Exonic
929452884 2:42048343-42048365 GCTCCCCGCGGCCCCCGCGACGG - Exonic
929788563 2:45008498-45008520 GCTCCCCGGGGCCCAAGGGAGGG - Intronic
932436544 2:71705308-71705330 CCTGTCCGGGACCCTGGCGGGGG + Intergenic
937043054 2:118835889-118835911 GCTTGCCCGGACCCTGGCGCGGG + Intergenic
938110738 2:128563258-128563280 CCTCCCCGGGCCCCTGGTGTAGG - Intergenic
942360766 2:175168740-175168762 GCTCCCCGGGAGCCTGAGGCGGG + Intergenic
947586668 2:231360849-231360871 GCGCCCCAGGACCCAGGCAATGG + Intronic
948836190 2:240627078-240627100 GCTGCCGGGGACCGTGGGGATGG - Intronic
1172407984 20:34703761-34703783 GCTCCCCGGGAACCGGGGGTTGG + Intronic
1173447889 20:43136910-43136932 GCTGCTGGGGACCCTGGGGAAGG - Intronic
1175429354 20:58891188-58891210 GCCCCCCGGGAGCCCGGGGAGGG - Intronic
1175900193 20:62357013-62357035 GCTTTCGGGGACCCTGGGGATGG + Intronic
1175967728 20:62667941-62667963 CCTCCCCTGGACCCTGGGAAGGG + Intronic
1176060124 20:63168876-63168898 GGTCCCCGGGTCCCTGGCTGGGG - Intergenic
1176117721 20:63440286-63440308 GCTCACCGGGACCCTTGGGGAGG - Intronic
1176546740 21:8205544-8205566 GCTCCCCGGCACCCGGGGGACGG - Intergenic
1176554635 21:8249734-8249756 GCTCCCCGGCACCCGGGGGACGG - Intergenic
1176565691 21:8388591-8388613 GCTCCCCGGCACCCGGGGGACGG - Intergenic
1176573556 21:8432759-8432781 GCTCCCCGGCACCCGGGGGACGG - Intergenic
1178784619 21:35641920-35641942 GCTCGCCTGGACCATGGCAACGG + Intronic
1179953217 21:44723527-44723549 TCCCCCCGGGGCCCTGGGGACGG - Intergenic
1180082473 21:45493209-45493231 GCTCCCCGGGACCCAAGGTAAGG + Exonic
1180092950 21:45542153-45542175 GGTCCGCGGGGCCCTGGGGAGGG - Intronic
1180092975 21:45542214-45542236 GGTCCGCGGGGCCCTGGGGAGGG - Intronic
1181017860 22:20081359-20081381 GCTCCCCTGGACCCTTGGCACGG - Intronic
1182355987 22:29722415-29722437 GCTCCCCAGGGCCCAGGAGAAGG - Intronic
1184129898 22:42511577-42511599 GCTCCCAGGAACCCGGGCAAAGG - Exonic
1184248895 22:43249257-43249279 GACACCCGGGACCCTGGAGATGG + Intronic
1185048331 22:48540281-48540303 GCTCCCCAGGACCAGGGCGGTGG + Intronic
1203251605 22_KI270733v1_random:121810-121832 GCTCCCCGGCACCCGGGGGACGG - Intergenic
1203259655 22_KI270733v1_random:166892-166914 GCTCCCCGGCACCCGGGGGACGG - Intergenic
951611277 3:24494901-24494923 GCTCCCCGGGACCCCGCCGCCGG - Intronic
954841510 3:53515695-53515717 GCTCCTCAGGACCCAGGTGATGG + Intronic
954932661 3:54297556-54297578 GCTCCCTGAGATCCTGGAGATGG + Intronic
961081556 3:124033030-124033052 GCTCCCCGGGAGGCCGGCGCGGG + Intergenic
963870523 3:150409698-150409720 GCTCGCCAGTACCCTGGCGGCGG + Exonic
968591050 4:1459862-1459884 GCCCCCCAGGACCCTGGCAAAGG + Intergenic
968701473 4:2059965-2059987 GGTCCCCGGGAGCCGGGCGCGGG - Intronic
968727771 4:2256245-2256267 GGTCCCCAGGACCCTGGGGTTGG + Intronic
969417362 4:7069194-7069216 GCGCCCTGGGATCCTGGGGAGGG - Intergenic
969968597 4:11022718-11022740 GCTCCACTGAACCCTGGCCAAGG + Intergenic
979756863 4:124351295-124351317 GCTCCCTGGGAGACTGACGAAGG - Intergenic
985810017 5:2075857-2075879 GGTCCCAGGGACCCTGGCCTGGG + Intergenic
985832186 5:2242031-2242053 GCTCCCCGGGGACCTGCCAACGG + Intergenic
987162186 5:15155801-15155823 GCTCACTGCGACCCTGGCGGTGG + Intergenic
988700780 5:33672520-33672542 GCTCACAGGGTCCCTGGCAAGGG + Intronic
992749605 5:79849913-79849935 ACTCCGAGGGACCCTGGAGACGG - Intergenic
996790690 5:127290433-127290455 CCTCCCAGGGACTCTGCCGAGGG + Intergenic
996790839 5:127291142-127291164 GCACCCCGGTACCCTGGCTAAGG - Intronic
1001426740 5:171627896-171627918 ACTCCCCTGGACCCTGGGGCAGG + Intergenic
1001683506 5:173575841-173575863 ACTCCCTGGGACCCTGAGGATGG + Intergenic
1002134329 5:177098587-177098609 GCTGCCCGGGAGACTGGCCAGGG - Intergenic
1004272940 6:14211325-14211347 GCTCGCGCGGACCCGGGCGACGG - Intergenic
1005875300 6:30006632-30006654 GCTCTCGGGGACCCTGGCCCTGG + Intergenic
1007754461 6:44090031-44090053 GCTCCCAGGGAAACTGGAGAGGG + Intergenic
1011243643 6:85299280-85299302 GCTCCACTGGACCCTGAGGAGGG + Intergenic
1013524107 6:110958757-110958779 GCGCCGCGGGACCATGGCGGCGG + Exonic
1015366318 6:132401369-132401391 GCTCCCCGGGACGGCGGCGGGGG - Exonic
1018442038 6:163822312-163822334 GCTCCCCGGCACCCTTGCTTGGG - Intergenic
1018733809 6:166672748-166672770 GCTCCCTGGGACACAGGGGATGG - Intronic
1019136030 6:169908126-169908148 GTCCCCAGGGCCCCTGGCGATGG - Intergenic
1019592794 7:1844186-1844208 GCTCCCCGGGGACCTGACGAGGG + Intronic
1019667135 7:2257554-2257576 GCTCCGCAGGGCCCTGGCGCAGG - Intronic
1021911722 7:25392161-25392183 GCATCCCGTGACCCTGGAGAAGG + Intergenic
1022285842 7:28956008-28956030 GCTCCCCGGGACCACTGCGCGGG - Exonic
1022540897 7:31134687-31134709 GCTCCACGGGCCCAGGGCGAGGG + Intergenic
1022741756 7:33129104-33129126 GCACCGCGCGACCGTGGCGAGGG - Intergenic
1029424787 7:100488757-100488779 GCTTCCCGAACCCCTGGCGATGG + Exonic
1029737009 7:102470550-102470572 CCTCCCTGGGAGCCTGGTGAGGG + Intronic
1032090810 7:128910616-128910638 GCACCTCGGGGCCCTGGCGCTGG - Exonic
1033062527 7:138122333-138122355 GCTCCATGGGGCCCTGGCGGAGG + Intergenic
1034672980 7:152871619-152871641 GAGCCCTGGGACCCTGGGGAAGG - Intergenic
1034896412 7:154879092-154879114 GCCCCCAGAGACCCTGGCAACGG - Intronic
1035398575 7:158550578-158550600 GCTCCCCGGGACTCAGCCAAAGG + Intronic
1037827011 8:22165560-22165582 GCCCCCCGGCCCCCCGGCGACGG + Intronic
1038000512 8:23387402-23387424 GGTGCCCGAGACCCTGGGGAGGG - Intronic
1043582712 8:81732559-81732581 GCTCCCCGGGGCCGCGCCGAGGG - Exonic
1047350178 8:124066418-124066440 GCTTCCTGGGATCCTGGCAAGGG - Exonic
1049000414 8:139822442-139822464 GCTCCCCAGGAGCCTGGGGCGGG - Intronic
1049319785 8:141989938-141989960 GCTGCGCGGGGCCCTGGAGAGGG - Intergenic
1049427382 8:142543510-142543532 GCTCCCCGGCAGCCAGGGGACGG + Intronic
1049936610 9:505556-505578 GTTCCACGGGACCCGGGTGAAGG - Intronic
1051365468 9:16318679-16318701 GCTACCCGGGCCCCTGGCCTGGG + Intergenic
1053025401 9:34724833-34724855 GCTCCCCAGGGCCCTGGCCCCGG - Exonic
1053036930 9:34833895-34833917 GCTCCCCAGGGCCCTGGCCCCGG - Intergenic
1053130050 9:35609533-35609555 GCTCCCCGGGAGCCCGATGAGGG + Exonic
1061873615 9:133533373-133533395 TCTCCCCGGGACCCTCGGGCAGG - Intronic
1061939270 9:133875334-133875356 GCTCCCCGGGGCTGTGGCGCTGG - Intronic
1062375939 9:136261957-136261979 GCTGCCCGAGAGCCTGGCCATGG - Intergenic
1062395663 9:136351660-136351682 GCTCCCTGGGGCCCTGGCCAAGG - Intronic
1062467005 9:136685976-136685998 GCTCCCCGGGACCCCGGCCTGGG + Intronic
1062659216 9:137619402-137619424 CCTCCCCGGCACCCTGGCCGAGG - Intronic
1203770446 EBV:47484-47506 GCCCCCCGAGACCCGGGAGACGG + Intergenic
1203468007 Un_GL000220v1:104961-104983 GCTCCCCGGCACCCGGGGGACGG - Intergenic
1203475828 Un_GL000220v1:148933-148955 GCTCCCCGGCACCCGGGGGACGG - Intergenic
1185508385 X:644900-644922 GCGTCCTGGGACCCTGGAGAAGG + Exonic
1190235486 X:48611897-48611919 GATCCACAGGACACTGGCGATGG - Intergenic
1197935491 X:131736368-131736390 ACTCCCAGGGAACCTGGGGAGGG - Intergenic
1200114720 X:153765077-153765099 GCTCCCCGGGTCCCTGTGAAGGG - Intronic