ID: 1102646275

View in Genome Browser
Species Human (GRCh38)
Location 12:114405896-114405918
Sequence ATGGTTGCCGGTGCTCTTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 107}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102646275_1102646286 20 Left 1102646275 12:114405896-114405918 CCTCCAAGAGCACCGGCAACCAT 0: 1
1: 0
2: 0
3: 8
4: 107
Right 1102646286 12:114405939-114405961 CTCCTTTACACCCCCAGGGAGGG 0: 1
1: 0
2: 0
3: 18
4: 194
1102646275_1102646288 28 Left 1102646275 12:114405896-114405918 CCTCCAAGAGCACCGGCAACCAT 0: 1
1: 0
2: 0
3: 8
4: 107
Right 1102646288 12:114405947-114405969 CACCCCCAGGGAGGGAAAGTTGG 0: 1
1: 0
2: 1
3: 27
4: 271
1102646275_1102646285 19 Left 1102646275 12:114405896-114405918 CCTCCAAGAGCACCGGCAACCAT 0: 1
1: 0
2: 0
3: 8
4: 107
Right 1102646285 12:114405938-114405960 CCTCCTTTACACCCCCAGGGAGG 0: 1
1: 0
2: 0
3: 14
4: 160
1102646275_1102646282 15 Left 1102646275 12:114405896-114405918 CCTCCAAGAGCACCGGCAACCAT 0: 1
1: 0
2: 0
3: 8
4: 107
Right 1102646282 12:114405934-114405956 CGCTCCTCCTTTACACCCCCAGG 0: 1
1: 1
2: 1
3: 9
4: 88
1102646275_1102646283 16 Left 1102646275 12:114405896-114405918 CCTCCAAGAGCACCGGCAACCAT 0: 1
1: 0
2: 0
3: 8
4: 107
Right 1102646283 12:114405935-114405957 GCTCCTCCTTTACACCCCCAGGG 0: 1
1: 0
2: 1
3: 13
4: 167

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102646275 Original CRISPR ATGGTTGCCGGTGCTCTTGG AGG (reversed) Intronic