ID: 1102646278

View in Genome Browser
Species Human (GRCh38)
Location 12:114405915-114405937
Sequence AGCGGGGCACTGAGATTATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 74
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 70}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102646278_1102646293 24 Left 1102646278 12:114405915-114405937 CCATATAATCTCAGTGCCCCGCT 0: 1
1: 0
2: 0
3: 3
4: 70
Right 1102646293 12:114405962-114405984 AAAGTTGGAAGCCCAGTGAATGG 0: 1
1: 0
2: 0
3: 17
4: 213
1102646278_1102646285 0 Left 1102646278 12:114405915-114405937 CCATATAATCTCAGTGCCCCGCT 0: 1
1: 0
2: 0
3: 3
4: 70
Right 1102646285 12:114405938-114405960 CCTCCTTTACACCCCCAGGGAGG 0: 1
1: 0
2: 0
3: 14
4: 160
1102646278_1102646283 -3 Left 1102646278 12:114405915-114405937 CCATATAATCTCAGTGCCCCGCT 0: 1
1: 0
2: 0
3: 3
4: 70
Right 1102646283 12:114405935-114405957 GCTCCTCCTTTACACCCCCAGGG 0: 1
1: 0
2: 1
3: 13
4: 167
1102646278_1102646282 -4 Left 1102646278 12:114405915-114405937 CCATATAATCTCAGTGCCCCGCT 0: 1
1: 0
2: 0
3: 3
4: 70
Right 1102646282 12:114405934-114405956 CGCTCCTCCTTTACACCCCCAGG 0: 1
1: 1
2: 1
3: 9
4: 88
1102646278_1102646288 9 Left 1102646278 12:114405915-114405937 CCATATAATCTCAGTGCCCCGCT 0: 1
1: 0
2: 0
3: 3
4: 70
Right 1102646288 12:114405947-114405969 CACCCCCAGGGAGGGAAAGTTGG 0: 1
1: 0
2: 1
3: 27
4: 271
1102646278_1102646286 1 Left 1102646278 12:114405915-114405937 CCATATAATCTCAGTGCCCCGCT 0: 1
1: 0
2: 0
3: 3
4: 70
Right 1102646286 12:114405939-114405961 CTCCTTTACACCCCCAGGGAGGG 0: 1
1: 0
2: 0
3: 18
4: 194

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102646278 Original CRISPR AGCGGGGCACTGAGATTATA TGG (reversed) Intronic