ID: 1102646279

View in Genome Browser
Species Human (GRCh38)
Location 12:114405931-114405953
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 394
Summary {0: 1, 1: 0, 2: 0, 3: 36, 4: 357}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102646279_1102646288 -7 Left 1102646279 12:114405931-114405953 CCCCGCTCCTCCTTTACACCCCC 0: 1
1: 0
2: 0
3: 36
4: 357
Right 1102646288 12:114405947-114405969 CACCCCCAGGGAGGGAAAGTTGG 0: 1
1: 0
2: 1
3: 27
4: 271
1102646279_1102646293 8 Left 1102646279 12:114405931-114405953 CCCCGCTCCTCCTTTACACCCCC 0: 1
1: 0
2: 0
3: 36
4: 357
Right 1102646293 12:114405962-114405984 AAAGTTGGAAGCCCAGTGAATGG 0: 1
1: 0
2: 0
3: 17
4: 213

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102646279 Original CRISPR GGGGGTGTAAAGGAGGAGCG GGG (reversed) Intronic