ID: 1102646281

View in Genome Browser
Species Human (GRCh38)
Location 12:114405933-114405955
Sequence CTGGGGGTGTAAAGGAGGAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 507
Summary {0: 1, 1: 0, 2: 3, 3: 49, 4: 454}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102646281_1102646293 6 Left 1102646281 12:114405933-114405955 CCGCTCCTCCTTTACACCCCCAG 0: 1
1: 0
2: 3
3: 49
4: 454
Right 1102646293 12:114405962-114405984 AAAGTTGGAAGCCCAGTGAATGG 0: 1
1: 0
2: 0
3: 17
4: 213
1102646281_1102646288 -9 Left 1102646281 12:114405933-114405955 CCGCTCCTCCTTTACACCCCCAG 0: 1
1: 0
2: 3
3: 49
4: 454
Right 1102646288 12:114405947-114405969 CACCCCCAGGGAGGGAAAGTTGG 0: 1
1: 0
2: 1
3: 27
4: 271

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102646281 Original CRISPR CTGGGGGTGTAAAGGAGGAG CGG (reversed) Intronic